KEGG   Boleophthalmus pectinirostris (great blue-spotted mudskipper): 110163690Help
Entry
110163690         CDS       T05002                                 

Gene name
neu4
Definition
(RefSeq) sialidase-4
  KO
K12357  
sialidase-2/3/4 [EC:3.2.1.18]
Organism
bpec  Boleophthalmus pectinirostris (great blue-spotted mudskipper)
Pathway
Other glycan degradation
Sphingolipid metabolism
Brite
KEGG Orthology (KO) [BR:bpec00001]
 Metabolism
  Lipid metabolism
   00600 Sphingolipid metabolism
    110163690 (neu4)
  Glycan biosynthesis and metabolism
   00511 Other glycan degradation
    110163690 (neu4)
Enzymes [BR:bpec01000]
 3. Hydrolases
  3.2  Glycosylases
   3.2.1  Glycosidases, i.e. enzymes that hydrolyse O- and S-glycosyl compounds
    3.2.1.18  exo-alpha-sialidase
     110163690 (neu4)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
NCBI-ProteinID: 
LinkDB All DBs
Position
Unknown
AA seq 447 aa AA seqDB search
MKSPYYPARSVLFHKEPNGVTYRIPALLYLPQSKTLLAFCEERLSPSDSQAHLLVMRKGI
FHRNYVEWEDMHVLGTAFLPGHRSMNPCPVQDEFTGTVFLFFIAVLGHTSEAHQLITGKN
VTRLCYISSTDNGNTWSPVTDLTQTVIGETIKEWATFALGPGHGIQLKSGRLLIPAYAYF
IECKECFGQLCQTTPHAFCFHSDTHGRTWHFGEAVPGPESVECQVVSVDEEEGTNILYCN
ARSPLGYRVQSVSMDDGAVFQEGQLVPRLVEPRNGCQGSVVGFPAPLHLNNCFSNDFSHH
THHHLKHWGPNFLNPTWVVYCHPTRNTTRKDLGVFLSLFPRDPDSWSGPWVIYDGPSAYS
DLAYMELSPSPEAPPAVAFACLFECGTSTAYDQICFSIFTLYELIDNIPHSIQQGPTSKK
HKHKIGGQLEDMPKRRKGKMREMCTIF
NT seq 1344 nt NT seq  +upstreamnt  +downstreamnt
atgaagtctccatactatccagcaagatctgtccttttccacaaggagcccaatggagtt
acatacaggatccctgcattgctctacctgccacagtccaaaaccctcttggctttctgt
gaagagagactcagcccctcagactcccaggctcatctgcttgtcatgaggaaaggcatt
tttcacaggaattatgtggagtgggaggacatgcatgttttgggcacagctttcttacct
ggtcataggtctatgaatccttgcccagtgcaggatgagttcactgggacagtctttctg
ttcttcatcgctgtgttggggcacacgtcagaggcccatcagctgataacgggtaaaaat
gtaacacgcctctgctacatctccagcacagacaacggcaacacttggagcccagtcact
gaccttacacaaacagtgataggagaaaccattaaagagtgggccacctttgcacttggc
ccaggtcatggcattcagctgaagtccggacgcctactgattcctgcctatgcttacttt
attgaatgcaaagagtgctttggacagctctgccagactacaccccatgcattttgtttc
catagtgacacccatgggcgaacgtggcactttggggaggctgtgccaggaccagagagc
gtggagtgtcaggtagtgtctgtggatgaagaagaaggcacaaacatattgtactgcaac
gctcgcagtcctcttggttacagggtgcagtctgtcagtatggacgatggggctgtgttt
caagaggggcaactggtcccacgtctagtagagcctcgaaatggctgtcaagggagcgta
gtggggtttccagcccctttacacctgaataattgtttcagcaatgattttagtcaccac
actcaccaccacttgaaacactgggggccaaattttctgaaccccacctgggtagtgtac
tgccaccccacaaggaacacaactcggaaagacttgggtgttttcttgagcctgtttcct
cgtgacccggacagttggagcggcccctgggtcatttatgatggtcccagtgcctactca
gacctggcctacatggagctttcaccatctcctgaagctccacctgcagtggcctttgcc
tgtctgtttgagtgtggcacaagcacagcttatgatcagatctgtttcagcatctttact
ctgtatgagctcatagataatataccgcacagcattcagcaaggtccaaccagcaaaaaa
cacaaacataaaataggaggacagttggaagatatgcccaagaggagaaaaggcaaaatg
agagaaatgtgcactattttttaa

DBGET integrated database retrieval system