KEGG   Burkholderia pseudomultivorans: WS57_30860Help
Entry
WS57_30860        CDS       T04870                                 

Definition
(GenBank) phosphoenolpyruvate carboxylase
  KO
K01595  
phosphoenolpyruvate carboxylase [EC:4.1.1.31]
Organism
bpsl  Burkholderia pseudomultivorans
Pathway
Pyruvate metabolism
Methane metabolism
Carbon fixation in photosynthetic organisms
Metabolic pathways
Microbial metabolism in diverse environments
Carbon metabolism
Module
CAM (Crassulacean acid metabolism), dark
Brite
KEGG Orthology (KO) [BR:bpsl00001]
 Metabolism
  Carbohydrate metabolism
   00620 Pyruvate metabolism
    WS57_30860
  Energy metabolism
   00710 Carbon fixation in photosynthetic organisms
    WS57_30860
   00680 Methane metabolism
    WS57_30860
Enzymes [BR:bpsl01000]
 4. Lyases
  4.1  Carbon-carbon lyases
   4.1.1  Carboxy-lyases
    4.1.1.31  phosphoenolpyruvate carboxylase
     WS57_30860
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
LinkDB All DBs
Position
1:4026014..4028998
Genome map
AA seq 994 aa AA seqDB search
MKSSGSARTTRRNAALPSTDAPTSTVTTAANGRAKPATKPKATIPQTKRAAGAAKPAART
REDKDRPLFEDIRFLGRLLGDVVREQEGDTVFDVVETIRQTAVKFRREDDHEAAQTLEKK
LRKLTPEQTVSVVRAFSYFSHLANIAEDRHHNRRRRIHALAGSAPQPGTMAYALDQLKTT
GNASKRLLQRFFDDALIVPVLTAHPTEVQRKSILDAQHDIARLLAERDQELTARERQHNE
AMLRARVTALWQTRMLRDARLTVGDEIENALSYYRATFLDELPALYGDIEAALAEHGLPA
RVPAFFQMGSWIGGDRDGNPNVTAATLDEAINRQSAVILEHYLEQVHKLGAELSVSNLLV
GANDAVKALAAASPDQSPHRVDEPYRRALIGIYTRLAASARVRLGEGTVPVRSAGRGAPP
VRATPYADSDEFVADLKVLTASLAEHHGASLAAPRLAPLMRAAEVFGFHLASIDLRQSSD
IHEAVVAELFARAGVEADYAGLAEEDKQRVLLAALADPRPLRSPYIEYSALAQSELGVFE
KARDVRAQFGARAVRNYIISHTETVSDLVEVLLLQKETGLLDGTLGTPDGHARSGLMVIP
LFETIPDLRDASRIMREYFALPGVEALIAHQGGEQEVMLGYSDSNKDGGFLTSNWELYRA
ELALVELFRARKITLRLFHGRGGTVGRGGGPTYQAILSQPPGTVNGQIRLTEQGEVIASK
FANPEIGRRNLETVVAATLEASLLPQSNAPAQLPAFEAAMQTLSDEAMAAYRALVYETPG
FTDYFFSSTPITEIAELNIGSRPASRKLQDPKNRRIEDLRAIPWGFSWGQCRLLLTGWYG
FGSAVSAYLDGAGDAAERGKRLALLKKMNKTWPFFANLLSNMDMVLAKTDLAVASRYAQL
VADRKLRKHVFERIVAEWERTSQALAEITGHEGRLATNPLLARSIKNRFPYLDPLNHLQV
ELIKRHRAGDTNARLRRGIHLTINGIAAGLRNTG
NT seq 2985 nt NT seq  +upstreamnt  +downstreamnt
gtgaagtcttccggatcggcgcgtacgacacgccgcaatgctgccctgccctccaccgac
gctccgacgagcaccgtcaccaccgccgcgaacggtcgtgcgaaaccggcaacgaaaccg
aaagccacgatacctcagacaaaacgcgcggccggcgcggcgaagcccgccgcacgcacg
cgcgaggacaaggaccgcccgctgttcgaggacatccgcttcctcggccgcctgctcggc
gacgtggtgcgcgaacaggaaggcgacaccgtgttcgacgtcgtcgagacgatccgccag
accgccgtcaagttccgccgcgaggacgaccacgaggccgcgcagacgctcgagaagaag
ctgcgcaagctgacgccggagcagacggtgagcgtcgtgcgcgcgttcagctatttctcg
catctcgcgaacatcgccgaggaccgtcatcacaaccgtcgccgccgcatccacgcgctg
gccggctcggcgccgcagccgggcacgatggcctatgcgctcgaccagctgaagacgacc
ggcaatgcatcgaagcgcctgctgcagcgcttcttcgacgacgcgctgatcgtgcccgtg
ctgaccgcgcacccgaccgaggtgcagcgcaagagcatcctcgacgcgcagcacgacatc
gcgcggctgctcgccgagcgcgaccaggaactgaccgcacgcgagcgccagcacaacgaa
gcgatgctgcgcgcgcgcgtgaccgcgctgtggcagacccgcatgctgcgcgacgcgcgc
ctgaccgtcggcgacgagatcgagaacgcgctgtcgtactaccgcgcgaccttcctcgac
gaactgcccgcgctgtacggcgacatcgaggccgcgctcgccgagcacggcctgcccgcg
cgcgtgcccgcgttcttccagatgggcagctggatcggcggcgaccgcgacggcaacccg
aacgtgacggccgcgacgctcgacgaggcgatcaaccgccagtcggcggtgatcctcgag
cactacctggaacaggtgcacaagctcggcgccgagctgtcggtgtcgaacctgctggtc
ggcgcgaacgacgcggtgaaggcgctcgcggcagcgtcgcccgaccagtcgccgcaccgc
gtcgacgaaccttaccgccgcgcgctgatcggcatctacacgcggctcgccgcgagcgcg
cgcgtgcgtctcggcgaaggcacggtgccggtgcgcagcgccggacgcggcgcgccgccg
gtgcgcgcgacgccgtacgcggattccgacgaattcgtcgccgacctgaaggtgctgacc
gcttcgctcgccgagcatcacggcgcgtcgctcgccgcaccgcgcctcgcgccgctgatg
cgcgcggccgaggtgttcggcttccatctcgcgagcatcgacctgcgccagagctcggac
atccacgaggcggtggtcgccgaactgttcgcgcgcgcgggcgtcgaggccgactacgcg
gggctcgccgaggaagacaagcagcgcgtgctgctggcggcgctcgccgacccgcgcccg
ctgcgctcgccgtacatcgaatactcggcgctcgcgcagagcgagctcggcgtgttcgag
aaggcgcgcgacgtgcgcgcgcagttcggcgcacgcgcggtgcgcaactacatcatctcg
catacggaaacggtcagcgacctcgtcgaggtgctgctgctgcagaaggaaaccgggctg
ctcgacggcacgctcggcacgcccgacggccatgcgcgcagcggcctgatggtgatcccg
ctgttcgagacgatccccgacctgcgcgacgcgtcgcgcatcatgcgcgagtacttcgcg
ctgccgggcgtcgaggcgctgatcgcgcaccagggcggcgagcaggaagtgatgctcggc
tactcggacagcaacaaggacggcggcttcctgacgtcgaactgggagctgtaccgcgcc
gagctcgcgctcgtcgaactgttccgtgcgcgcaagatcacgctgcggctgttccacggc
cgcggcggcacggtcggccgcggcggcggcccgacctaccaggcgatcctgtcgcagccg
ccgggcaccgtgaacggccagatccgcctgaccgaacagggcgaggtgatcgcgagcaag
ttcgcgaaccccgagatcggccggcgcaacctcgagacggtggtcgccgcgacgctcgag
gcgtcgctgctgccgcagtcgaacgcaccggcgcaactgcccgcgttcgaggccgcgatg
cagacgctgtccgacgaggcgatggccgcgtaccgtgcgctcgtctacgaaacgcccggc
ttcaccgactacttcttctcgtcgacgccgatcaccgagatcgccgagctgaacatcggc
agccgtccggcgtcgcgcaagctgcaggatccgaagaaccgccggatcgaggatctgcgc
gcgattccgtggggcttctcgtggggccagtgccggctgctgctgaccggctggtacggc
ttcggcagcgcggtgagcgcgtacctcgacggcgcgggcgacgcagccgagcgcggcaag
cggctcgcactgctgaagaagatgaacaagacctggccgttcttcgcgaacctgctgtcg
aacatggacatggtgctcgcgaagaccgatctcgcggtcgcctcgcgctatgcgcagctg
gtggccgaccgcaagctgcgcaagcacgtgttcgagcggatcgtcgccgaatgggagcgc
acctcgcaggcgctcgcggaaatcaccgggcacgaaggccgcctcgcgaccaacccgctg
ctcgcgcgttcgatcaagaaccgcttcccgtatctcgacccgctgaaccatctgcaggtc
gaactgatcaagcgacaccgcgcgggcgataccaacgcgcggctgcgccgaggcattcat
ctgacgatcaacgggatcgcggccggcctgcgcaacacgggctga

DBGET integrated database retrieval system