KEGG   Bradyrhizobium sp. ORS 285: BRAD285_0865Help
Entry
BRAD285_0865      CDS       T04956                                 

Definition
(GenBank) putative Acyl-CoA synthetase (AMP-forming)/AMP-acid ligase II
Organism
bro  Bradyrhizobium sp. ORS 285
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
LinkDB All DBs
Position
851285..853402
Genome map
AA seq 705 aa AA seqDB search
MVEALRSNALMMPERAAFRFLPAASVTADISYAELDRVATRLAVRLRKSGLRRGDRVLMF
YPPGLEFVSAFFAVLYAGAVAVPLALPRRAGGGGAIAALIENSEPAMVLTSASLQARLDG
LVSASGHPLPTIATDTLPLDGAGLDDAGDGELIMPSPDELCVLQYTSGSTGLPRGVAVTH
GNAARNALLLGRQAELDTGSVWVSWVPHFHDLGLFGSICTSLYHGATAILMPPAAFVSRP
VRWLEAISRFGGTITIAPNFAYDLCLRQVAEEDCVGLDLRHWRVAGSGAEPINQQTMDRF
AERFASYGLDPRAMCPFYGLAEATLLVSGGPVWGGQSALTVSHAAMKQRAIRDADTAEDA
YSLPSCGVPSPEHRILIVDPDTRQPCAPDAIGEIWIDGSTTGPGYWRNPDETERVFGARL
ADGEGPYLRTGDLGVMRDGTLHVCGRIKDVMIVHGQNVYPQDVELTAREAVPEITEAAAF
TTPDRASEQPILVIEQPRRGWRDTAAVLETVRSAVSARHGIELTRVVVTQHRLLPKTSSG
KIQRSRARAMLADGSLPIQAEWNSELDEAAAEEQRLDAVELVIALKGQTRSQQERSIEDY
LRDILRDLAGIDADQLGPDDPLMAFGVTSLGLMRIRSRIESDFMVRIDSTRLWQDCCLAE
LGRELHARLLVSPLWAEADMLRGLAMEVARMDDSEVARALGAGQA
NT seq 2118 nt NT seq  +upstreamnt  +downstreamnt
atggtggaggcgttgcgatcgaacgcgctgatgatgccggagcgggccgcattccgcttt
ctgccggctgcgtcggtgacggccgacatcagttatgccgaactcgatcgcgttgcgacg
cgattggcggtgcggctgcgcaagtcgggacttaggcgtggcgaccgtgtcctgatgttc
tacccgccggggctggagttcgtgagcgcgttcttcgcggtgctctatgcaggtgcggtg
gcggtgccgctcgcgttgccgcgtcgcgcaggcggtggcggcgccatcgcggcgctgatc
gagaattccgagccggcgatggttctgacatctgcgtcgctgcaggcgcggctcgatggc
ttggtgtcggcgtccggccatccgctgccaacgattgcaactgacacgcttccgctcgat
ggcgcaggcctcgacgacgcaggcgacggcgagctgatcatgccgtcgcccgacgagctc
tgcgtgctgcaatatacgtccggctcgaccggtttgccccgcggcgtcgcggtgacccat
ggcaatgcggcgcgcaacgcgcttctgctcggccgtcaggccgagctcgacaccggctcg
gtgtgggtcagctgggtgccgcacttccacgatctcggcctgttcggcagtatctgcacc
tcgctctatcacggcgccactgccatcctgatgccgccggccgccttcgtcagtcgtccg
gtccgctggctggaggccatctcacgcttcggcggcacgatcacgatcgcgccgaacttc
gcctatgatctctgcctacggcaggtggccgaggaagactgcgtcggccttgatctgcgc
cactggcgcgtcgcgggctccggcgccgagccgatcaatcagcagaccatggaccgtttc
gccgaacgtttcgcgtcctacgggctcgaccctcgcgcgatgtgtccgttctacgggctg
gccgaagcgacgctgctcgtctccggcggaccggtgtggggcgggcagtcggccttgacc
gtgtcacatgcggcgatgaagcaacgcgcgatccgcgacgccgacactgccgaggatgcc
tacagtttgccctcatgcggtgtgccgagcccggagcatcgcattctcatcgtcgatccc
gacacgcgacagccttgtgcgccggatgcgatcggcgagatctggatcgacggctcgacc
accggtcctggctattggcgcaatcccgacgagaccgagcgcgtgttcggcgcgcgcctt
gccgacggtgagggcccctatctgcggaccggcgatctcggcgtgatgcgcgacggtacg
ctccatgtctgcgggcggatcaaggacgtgatgatcgttcacggtcagaacgtctatccg
caggacgtcgagctgacggcgcgcgaagccgttcccgagatcaccgaagcggcggcgttc
accacgcccgatcgcgcatcggagcagcccatcctggtgatcgagcagccgaggcggggc
tggcgcgataccgcggccgtgcttgagaccgtgcggtccgcggtgtcggcgcggcacggc
atcgagctcacgcgtgtcgtggtgacgcaacatcgtctgctgccgaagacctcgagcggc
aagatccagcgctctcgcgcccgcgcgatgctggccgacggctcgctgccgatccaggcc
gagtggaactcggagctcgacgaggcggcggcggaggagcagcgactcgacgcggtcgaa
ctcgtgatcgccttgaaggggcagacgcgctctcagcaggagcggtcgatcgaggactat
ctgcgcgacattctgcgcgacttggccggcatcgatgccgaccagctcggtccagatgat
ccgttgatggcgttcggcgtgacgtcgctcgggctgatgcggatcaggagcagaatcgag
agcgacttcatggtgcggatcgattcgacacggctgtggcaggactgctgcctcgccgag
ctcgggcgcgagctgcacgcgcgtttgctggtctcgccgctgtgggccgaggccgacatg
ctgcggggtctcgccatggaggtcgccagaatggacgacagcgaagtcgcccgcgcattg
ggtgcaggccaagcctga

DBGET integrated database retrieval system