KEGG   Cupriavidus sp. USMAA1020: BKK80_15295Help
Entry
BKK80_15295       CDS       T04978                                 

Definition
(GenBank) FAD-dependent oxidoreductase
  KO
K00111  
glycerol-3-phosphate dehydrogenase [EC:1.1.5.3]
Organism
cup  Cupriavidus sp. USMAA1020
Pathway
Glycerophospholipid metabolism
Biosynthesis of secondary metabolites
Brite
KEGG Orthology (KO) [BR:cup00001]
 Metabolism
  Lipid metabolism
   00564 Glycerophospholipid metabolism
    BKK80_15295
Enzymes [BR:cup01000]
 1. Oxidoreductases
  1.1  Acting on the CH-OH group of donors
   1.1.5  With a quinone or similar compound as acceptor
    1.1.5.3  glycerol-3-phosphate dehydrogenase
     BKK80_15295
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
LinkDB All DBs
Position
1:3392148..3393755
Genome map
AA seq 535 aa AA seqDB search
MPTPFTQILPPARADLLAGLAREPRWDVIVIGGGATGLGTAVDAASRGYRTLLVEAADFA
KGTSSKATKLVHGGVRYLAQGNISLVREALHERGLLARNAPHLVWPLGFVVPAYQMLDQP
FYGIGLKVYDMLAGNLKLAGSRWLNHRETLAAAPTLAEHVGGRPLRGGNLYFDGQFDDAR
LAIALMRTLFDVGGTAVNYLRVTGLLQQGGAVTGVTVQDALGEACFALQAKCVINATGVW
VDAVRRMEDGQARTMVAPSQGVHLTLPRSFLPGQDAILIPRTDDGRVLFVVPWNGHTIVG
TTDTPRQDLPLEPRAAGDDVDFILETAARYLSRSPTRADVTSVWAGLRPLVKATGENTTA
SLSREHTILVSKGGLITVTGGKWTTYRKMAEDVVDTAIQRGLVARAAPCITTELALHGAQ
GLPADLPASGSGSPDRYYGNELGALRALPGQDEVLMAGSGLTAAHVRFAARHEMARRVED
VLARRNRALFLDARGASAAAPRVAAILAEELQHDAAWQTREVEDFRKLASGYMLD
NT seq 1608 nt NT seq  +upstreamnt  +downstreamnt
atgccaacgcctttcacccagatcctgccccctgcccgcgccgacctgctcgccggcctc
gcgcgcgaaccgcgctgggacgtgatcgtcatcggtggcggcgccaccggcctgggcacg
gccgtcgacgcagcctcgcgcggctaccgcacgctgctggtcgaggccgcggacttcgcc
aaaggcacctccagcaaggccaccaagctcgtgcacgggggcgtgcgctacctcgcgcag
ggcaatatcagcctggtgcgtgaggccttgcacgaacgcggcctgctggcccgcaacgca
ccgcacctggtgtggccgctcggcttcgtcgtgccggcctaccagatgctggaccagccc
ttctacggcatcggcctcaaggtctacgacatgctcgcgggcaacctcaagctggccggc
agccgctggctgaaccaccgcgagacgctggccgccgcgcccacgctcgccgaacacgtg
ggcggacgcccgctgcgcggcggcaacctgtacttcgacggccagttcgacgacgcacgg
ctggcgatcgccctgatgcgcaccctcttcgacgtgggcggcaccgcggtcaactacctg
cgcgtgaccggcctgctgcagcaaggcggcgccgtcaccggcgtcaccgtgcaggacgcg
ctcggcgaggcctgcttcgccctgcaggcgaagtgcgtgatcaacgccaccggcgtctgg
gtggatgccgtgcgccgcatggaggacggccaggcccgcaccatggtggcgcccagccag
ggcgtgcacctgacgctgccgcgcagcttcctgcccggccaggacgccatcctgatcccg
cgcaccgacgacggccgggtactgttcgtggtgccctggaacggccacaccatcgtcggc
accaccgacaccccgcgccaggacctgccgctcgaaccgcgcgccgccggcgacgacgtc
gacttcatcctggaaacggcggcgcgctacctgtcccgctcgcccactcgcgccgacgtc
accagcgtctgggccgggctgcgcccgctggtcaaggcgaccggggaaaacaccaccgca
tcgctgtcgcgcgagcacaccatcctggtctccaagggcggcctgatcaccgtgaccggc
ggcaagtggaccacctatcgcaagatggcggaggacgtggtggacaccgccatccagcgc
gggctggtggcgcgcgctgcgccctgcatcacgacggaactggcgttgcatggcgcacag
ggcctgccggccgacctgccggcatccggcagcggctcacccgatcgctattacggcaac
gaattgggagccttgcgcgcactgcctggccaggacgaggtgctgatggcgggctccggg
ctgaccgccgcccacgtccgcttcgccgcgcgccacgaaatggcgcggcgcgtcgaggac
gtgctggcgcgccgcaatcgcgccctgttcctcgatgcgcgtggcgccagcgcggccgcg
ccgcgcgtggcggccatcctggccgaggaactgcagcacgatgctgcctggcaaacccgc
gaagtggaggacttccgcaagctcgcctcgggttatatgctcgactga

DBGET integrated database retrieval system