KEGG   Cyanobium sp. NIES-981: CBM981_2754Help
Entry
CBM981_2754       CDS       T04888                                 

Gene name
sodB
Definition
(GenBank) superoxide dismutase, Fe
  KO
K04564  
superoxide dismutase, Fe-Mn family [EC:1.15.1.1]
Organism
cyi  Cyanobium sp. NIES-981
Brite
Enzymes [BR:cyi01000]
 1. Oxidoreductases
  1.15  Acting on superoxide as acceptor
   1.15.1  Acting on superoxide as acceptor (only sub-subclass identified to date)
    1.15.1.1  superoxide dismutase
     CBM981_2754 (sodB)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
LinkDB All DBs
Position
I:2508952..2509551
Genome map
AA seq 199 aa AA seqDB search
MAHTLPTLPYGLDALEPHISRQTLEFHHGKHHNAYVTNLNKLVEGTDLDGKSLEDTITAV
AGDAGRAGVFNNAAQVWNHSFYWQCMKPGGGGQPTGALAEKINADFGSFEAFVEQFKTAG
ATQFGSGWAWLVLDGGTLKVTKTANADLPLAHGQKALLTMDVWEHAYYLDYQNRRPDYIT
TYLEKLVNWDFVAANLAAA
NT seq 600 nt NT seq  +upstreamnt  +downstreamnt
atggcccatacgctgcccacgctgccctacggcctcgatgcgctcgagccccatatctcc
cgtcagaccctcgagttccatcacggcaagcaccacaacgcctacgtcaccaacctcaac
aagctggtggagggcacggacctcgacggcaagagcctcgaggacaccatcacggccgtg
gcaggtgacgcgggcagggccggcgtgttcaacaacgccgcccaggtgtggaaccacagc
ttctactggcagtgcatgaagcccggtggtggtgggcaacccaccggcgccctggccgag
aagatcaatgccgacttcggcagcttcgaagccttcgtggaacagttcaagaccgccggc
gccacccagttcggcagcggctgggcctggctggtgctggacggcggcaccctcaaggtg
accaagaccgccaacgccgacctgcccctggcccatggccagaaggccctgctcaccatg
gacgtgtgggagcacgcctactacctcgactaccagaaccgccgccccgactacatcacc
acctacctcgagaagctggtgaactgggacttcgtggccgccaacctggccgctgcctga

DBGET integrated database retrieval system