KEGG   Desulfotomaculum ferrireducens: B0537_01865Help
Entry
B0537_01865       CDS       T04823                                 

Definition
(GenBank) translation elongation factor Tu
  KO
K02358  
elongation factor Tu
Organism
dfg  Desulfotomaculum ferrireducens
Brite
Translation factors [BR:dfg03012]
 Eukaryotic Type
  Elongation factors
   B0537_01865
 Prokaryotic Type
   B0537_01865
Mitochondrial biogenesis [BR:dfg03029]
 Mitochondrial DNA transcription, translation, and replication factors
  Mitochondrial transcription and translation factors
   Mitochondrial translation factors
    B0537_01865
Exosome [BR:dfg04147]
 Exosomal proteins
  Exosomal proteins of haemopoietic cells  (B-cell, T-cell, DC-cell, reticulocyte, and mast cell)
   B0537_01865
  Exosomal proteins of breast cancer cells
   B0537_01865
  Exosomal proteins of colorectal cancer cells
   B0537_01865
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
LinkDB All DBs
Position
368538..369740
Genome map
AA seq 400 aa AA seqDB search
MAKAKFERTKPHVNIGTIGHVDHGKTTLTAAITIVLSTIGGAAVKRYDEIDNAPEERERG
ITINTSHVEYETANRHYAHVDCPGHADYVKNMITGAAQMDGAILVVSAADGPMPQTREHI
LLSRQVGVPYIVVFLNKADMVDDPELLELVDMEVRELLNSYEFPGDDTPIVAGSGLKALE
CGCGKRECEWCGKIWELMDNVDKYIPTPERAVDKPFLMPVEDVFSITGRGTVATGRVERG
QVKVQDEVEIVGLNDKPRKTVVTGVEMFRKLLDYAQAGDNIGTLLRGVDRKEIERGQVLA
KPGSIKPHTKYSAEVYVLTKEEGGRHTPFFNGYRPQFYFRTTDVTGVIQLPEGVEMVMPG
DNIKVDVDLITPIAIEEGLRFAIREGGRTVGAGVVTGIRE
NT seq 1203 nt NT seq  +upstreamnt  +downstreamnt
atggctaaggctaaatttgaacgtaccaaaccccacgttaacattggtaccattggtcac
gtagaccatggcaaaaccactctgaccgcagctattaccattgttctgtcaaccattggc
ggtgctgctgtaaaacgttacgatgaaattgacaacgctcctgaagagcgtgaacgtggt
attaccattaacacctcccacgttgaatatgaaaccgctaaccgtcactatgcccacgtt
gactgccccggtcacgctgactatgttaagaacatgatcaccggtgctgctcaaatggac
ggtgccatcctggttgtatctgccgctgacggccccatgcctcaaacccgtgagcacatc
ctgctctcccgtcaggtaggcgtaccctatattgtagtattcttaaataaagccgatatg
gttgacgatcctgaactgcttgaactggtagacatggaagttcgtgaactgctcaactcc
tatgaattccctggcgatgacacccccatcgtagccggctccggcctaaaagctctggaa
tgtggctgcggtaagcgcgagtgcgaatggtgtggcaagatttgggaactgatggacaat
gtagacaagtacattcctactcccgaacgtgcagtagataagcccttcctgatgcccgta
gaagacgtgttctccattaccggtcgtggtactgtagccaccggtcgtgtagagcgtggt
caagtaaaagtacaagatgaagtagaaatcgtaggtctcaatgacaagcctcgtaagacc
gtagtaaccggcgtagaaatgttccgcaaactgctggactatgcccaagctggtgataac
attggtactctgctgcgcggtgtagaccgtaaagaaattgaacgtggtcaagtactggct
aagcctggcagcattaagcctcacaccaaatactctgcggaagtatatgtactgaccaaa
gaagaaggtggccgtcacaccccattctttaacggctatcgtcctcaattctacttccgt
accaccgacgtaactggcgttattcaactgcctgagggtgtagaaatggttatgcccggt
gacaacattaaagtagacgttgacctgattacccccatcgctatcgaagaaggtctgcgc
tttgctattcgtgaaggcggccgtaccgtaggcgctggtgtagtaaccggtattcgtgaa
taa

DBGET integrated database retrieval system