KEGG   Francisella sp. TX077310: F7310_01155Help
Entry
F7310_01155       CDS       T05017                                 

Definition
(GenBank) phosphoenolpyruvate carboxylase
  KO
K01595  
phosphoenolpyruvate carboxylase [EC:4.1.1.31]
Organism
frx  Francisella sp. TX077310
Pathway
Pyruvate metabolism
Methane metabolism
Metabolic pathways
Microbial metabolism in diverse environments
Carbon metabolism
Module
CAM (Crassulacean acid metabolism), dark
Brite
KEGG Orthology (KO) [BR:frx00001]
 Metabolism
  Carbohydrate metabolism
   00620 Pyruvate metabolism
    F7310_01155
  Energy metabolism
   00680 Methane metabolism
    F7310_01155
Enzymes [BR:frx01000]
 4. Lyases
  4.1  Carbon-carbon lyases
   4.1.1  Carboxy-lyases
    4.1.1.31  phosphoenolpyruvate carboxylase
     F7310_01155
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
LinkDB All DBs
Position
complement(233224..235758)
Genome map
AA seq 844 aa AA seqDB search
MSFYSIQDELLENYKSKVELKYKMLNGLFLSTPLDKKHNANFKLATFANICKSELKNGKD
PIEIIENIYPEMSEEEKLETFIKFIRYIERQIVLVDALEEAAYAKTHDLNGEYSITRLTR
RVERHNKQNSLNKALKEYKTRLVLTAHPTQFYAKLVLPIIHDLKKAITDNDINKIQDIFL
QMGKTKFSNKTKPTPEGEAISIIWYLNNIFYNTIPKIQHKLTNDNTNIELGFWPGGDRDG
NPFVTAKVTKRVSKHLRVSIFDCYNKDLKKLIKKLTFENVHDELTKIRKKLKANRYSSAQ
EFLNELVKIKKVVDTQYDSLFVDRLDNLILKVKIFGFHFAKLDVRQNARIHKQFFTEVFK
ENYSLDYETLKETQKIKLLIKLAKQKSFAELEHSSELAKELIETIATIQYIQQQNGYEAI
ERYIISNADSTVSILEVLTIFELFNKNTKGQDKIKIEVVPLFETMEDLKNSTQILDDLLK
IKLYTDNLKIWQNTQTIMLGFSDGTKDGGYFMANWSILEAKRALSKYLSSKGIKPIFFDG
RGGPPSRGGGDMFLFYRGLSNVVSNHDVQVTIQGQSISSKFGNSDSAQYNLEQILTSGLY
GKLNLHNAHKLNSTELNLINELGKLSFDTYIGLKNHPQFIDYLTEVTPLKYISEMNVGSR
PSKRNSGDKIKLDDLRAIPYGAAWTQMRQSILAFYGLGTAINRVVKKDPDNLDLIQKIYK
RSLIIKGIFDNALQSIVQTNFNMTKHISKDPKYSDFWQQIHNEHALAKEYLLAVTGKNED
FLHANPVKERSIKMRDDITLPLVILQQYALSALRKNSNHKYKNLLNTIIKKSLAANINAN
QNSI
NT seq 2535 nt NT seq  +upstreamnt  +downstreamnt
atgtccttttactctatccaagatgaacttctagagaactataaatctaaagttgaactt
aaatataaaatgctcaatggtctttttctaagtactcctcttgataaaaaacataatgca
aactttaaattagcaacatttgctaatatctgcaaaagtgagctaaaaaatggtaaagac
ccgatagaaattattgaaaacatatatcctgagatgtcagaagaagaaaaactcgagaca
ttcataaaatttatccgttatatagagagacaaatagtcttagtcgatgccttagaagaa
gctgcttatgctaaaacacatgatctaaatggtgaatatagtatcactagattaactaga
agagtagaaagacacaataagcagaactctttaaataaggccctaaaagagtataaaaca
aggcttgttcttacagcacaccctacccagttttatgccaaactagtgttacctattatt
catgatcttaagaaagctatcacagataatgatataaataaaattcaagatattttccta
cagatgggaaaaactaagtttagtaacaagactaaacctactccagaaggcgaagcaata
tcaatcatatggtacttaaataatattttttataatactatccccaaaattcagcataaa
ctaactaatgataataccaatattgagcttggattctggcctggaggtgatagagatggt
aatccatttgtgaccgcaaaagtaactaaaagagtatctaaacatttaagagtaagtatt
tttgattgctataacaaagatctaaaaaaacttattaaaaaactaacttttgaaaatgtt
catgatgaactcacaaagattagaaaaaaactaaaagctaatagatattcttcagcacaa
gaattcttaaatgagttagttaaaataaaaaaagttgttgacacacagtacgactcatta
tttgttgatagacttgataatttgattttaaaggtaaagatcttcggttttcattttgca
aaattagatgttcgtcagaatgctagaatacataaacaattcttcacagaggtttttaaa
gaaaactatagtttagactatgaaacgctcaaagaaacacaaaaaatcaagcttctaatt
aagcttgctaaacaaaaaagctttgcagagctagaacatagtagcgagttagctaaagaa
ctgatagaaactattgcgactatacaatatatccagcaacaaaatggctatgaagctata
gaaagatatatcattagcaatgctgactctaccgtaagtatcttagaagttttaacaata
ttcgaactttttaataagaatactaaaggtcaagataaaatcaaaatcgaagttgttcca
ttatttgaaactatggaagatttaaaaaactcaacgcaaatcttagatgatttactaaaa
ataaaactctatacagataacttaaaaatctggcaaaacacgcaaacaattatgcttgga
ttctctgatggcacaaaagatggtggttattttatggctaactggtcaatccttgaggct
aaacgagccctaagtaaataccttagctctaaagggatcaaacctatcttttttgatggt
cgtggtggccctccttcacgcggaggtggtgatatgtttttattctatagaggtttatca
aacgtagtttcaaatcatgatgttcaagtaaccatccagggacaaagcatatcatctaaa
tttggtaattctgatagtgctcagtataacctagagcagattctcacatcaggtctatat
ggcaagctaaacctacataatgcgcataaattaaactctacagagcttaatcttataaat
gagctaggtaaactgtcttttgatacatatataggccttaagaatcaccctcagtttata
gattacctaacagaagtaactcctcttaagtatattagtgagatgaatgtaggctcgcgc
ccatcaaagagaaactctggagataagatcaagctagatgatttacgagctattccttat
ggtgctgcctggacacaaatgagacaaagcatcttggcattttatgggcttggaacagca
ataaacagagtggtcaaaaaagatcctgacaatctagatttgatccaaaagatatataag
cgctcacttataatcaaaggaatatttgataatgctctacaaagtatcgtccaaacaaat
ttcaatatgactaaacatataagtaaagaccctaagtatagtgatttttggcaacaaata
cacaatgagcacgctctagcgaaagagtacttattggcagtaacaggtaaaaatgaagat
tttttacacgcaaaccctgtcaaagaaagatctataaaaatgagagatgatattacccta
cctctagttatattgcagcaatatgcacttagcgctctaaggaaaaattctaatcataaa
tacaaaaatcttctaaatactataatcaagaaatccttagctgcgaatattaatgcaaac
caaaattctatataa

DBGET integrated database retrieval system