KEGG   Herbaspirillum sp. meg3: hmeg3_16910Help
Entry
hmeg3_16910       CDS       T05024                                 

Definition
(GenBank) phosphoenolpyruvate carboxylase
  KO
K01595  
phosphoenolpyruvate carboxylase [EC:4.1.1.31]
Organism
hee  Herbaspirillum sp. meg3
Pathway
Pyruvate metabolism
Methane metabolism
Metabolic pathways
Microbial metabolism in diverse environments
Carbon metabolism
Module
CAM (Crassulacean acid metabolism), dark
Brite
KEGG Orthology (KO) [BR:hee00001]
 Metabolism
  Carbohydrate metabolism
   00620 Pyruvate metabolism
    hmeg3_16910
  Energy metabolism
   00680 Methane metabolism
    hmeg3_16910
Enzymes [BR:hee01000]
 4. Lyases
  4.1  Carbon-carbon lyases
   4.1.1  Carboxy-lyases
    4.1.1.31  phosphoenolpyruvate carboxylase
     hmeg3_16910
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
LinkDB All DBs
Position
3747363..3750260
Genome map
AA seq 965 aa AA seqDB search
MPTKPQTKTSARNTPSPSSSSIEKRPVKSADKDAPLKEDIRLLGRLLGEVLRDQEGDAVF
EVVETIRQTAVRFRRESDAKAGAELDKLLKKLTRDQTNSVVRAFSYFSHLANIAEDQHHN
RRRRAHLLAGSAPQPSSVAYALSRLDNAGVSGNTVRNFLSESLISPVLTAHPTEVQRKSI
LDAEREIARLLALRDSPLTPKELRDNTELLRARIATLWQTRMLRYTKLTVADEIENALSY
YRITFLRELPALYDDIEEEINAQFPSRARSRTTQAELPPFVQMGSWIGGDRDGNPNVNAG
TMQRALQRQSTTIFDFYLDEVHALGAELSISTLMVDASAELLALADTSPDTSNHRADEPY
RRALIGVYARLAATARNLGVVNILRQEVGAAAHYDTPEECIRELQVLIDSLNANHGAALV
KPRLAVLKRSIEIFGFHLATLDMRQSSDVHERVLSELFASAQVETSYASLSEEKKIALLL
AELSKPRLLYSPYLTYSDETNSELTILRAAREIRQRYGARAIRNYIISHTETASDLLEVL
LLQKETGLLHADAKDPSKLVELELMVIPLFETIPDLRCAADIMEQWLSFPLVAPLIAKQG
KLQEVMLGYSDSNKDGGFLTSNWELYKSENRLVELFNRAGVKLRLFHGRGGTVGRGGGPS
YQAILAQPPGTVNGQIRLTEQGEIIASKFSNPEIGRRNLELLVAATLEASLMPETTDAKE
TRKLAEFERVMEDLSERAYQAYRNLVYETPGFTDYFFASTPIAEIAELNIGSRPASRKST
RRIEDLRAIPWGFSWGQCRLLFPGWYGFGSAVSEWLQEGGTKESAKKLAALRAMYKEWPF
FAALLSNMDMVLSKTDLAVASRYAGLVADRKLRTAIFGRIVSEHERTSHLLSSITGNKDR
LAGNPLLARSIKNRFAYLDPLNHLQVELIKRHRSTAAAGKKVEERVQRGIHLTINGVAAG
LRNTG
NT seq 2898 nt NT seq  +upstreamnt  +downstreamnt
atgccaactaaaccacaaactaaaacttctgctcgcaatacccctagccctagctccagc
tccatcgaaaaacgccccgtcaagtccgcagacaaggacgctccgctcaaagaagacatc
cgcctgctcggccgtctgctcggcgaagtgctgcgcgaccaggaaggtgacgccgttttc
gaggtggtcgaaaccatacgccagacggccgtgcgctttcgccgcgaatccgacgccaag
gccggcgccgaactcgacaagctgctcaagaagctgacccgcgaccaaaccaattcggtg
gtgcgcgcgttctcgtacttctcgcatctggccaatatcgccgaagaccagcaccacaac
cgccgccgccgcgcccacttgctggccggctcggcaccacagcctagcagtgtggcctac
gcgctgtcgcgcctggacaatgctggcgtgtccggcaacaccgtgcgcaacttcctgtcg
gaatcgctgatctcgccggtgctgactgcgcatccgaccgaagtgcagcgcaagagtatt
ctcgatgcagagcgcgaaatcgcccgcctgctggcgctgcgcgacagcccgctgacaccg
aaggagttgcgcgacaacaccgaactgctgcgcgcgcgcatcgctacgctgtggcaaacc
cgcatgctgcgctacaccaagctgaccgttgccgatgaaatcgaaaacgcgctgtcctat
taccgcatcaccttcctgcgtgaactgccggcgttgtacgacgacatcgaagaagaaatc
aacgcgcagtttccgtcccgcgcacgttcgcgcaccacgcaggcggaactgccgcccttc
gtgcagatgggcagctggatcggcggcgaccgcgacggcaatcccaacgtcaacgccggc
accatgcagcgcgcgctgcaacgccagtcgaccacgatcttcgacttctacctcgatgaa
gttcatgcgcttggtgccgaattgtcgatctcgaccctgatggtcgacgccagcgctgag
ctgctggcgctggccgacacttcgcccgacacctccaaccatcgcgccgacgagccatac
cgccgcgcgctgatcggcgtttatgcgcgcctggcggcaaccgcccgcaatctcggcgtg
gtcaacatcctgcgccaggaagtcggcgccgctgcgcattacgacacaccggaagaatgc
atcagggaactgcaggtgctgatcgattcgctcaacgccaatcacggcgctgcgctggtc
aagccgcggctggcggtactgaagcgctcgattgaaatcttcggtttccacctcgccacg
ctggacatgcgtcaaagctccgacgtgcatgagcgtgtactgagcgaactgttcgccagc
gcgcaagtggagacatcctatgccagcctgagcgaagaaaagaagatcgcgctgctgctg
gcggaactctccaagccgcgcctgctgtattcgccgtacctgacctattcagacgagacc
aattccgagctgaccatcctgcgcgcggcgcgtgagatccgccaacgctatggcgcgcgc
gcgatccgcaactacatcatctcgcacacggaaaccgcgtccgacttgctggaagtgctg
ttgctgcaaaaggaaaccggcctgctgcatgccgatgcgaaagatccatccaagctggtc
gaactcgaactgatggtgatcccgctgttcgaaaccatccccgacttgcgctgcgccgcc
gacatcatggagcaatggctgtcgttcccgctggtggcgccgttgattgccaagcaaggc
aagctgcaggaagtgatgctgggctattccgactccaacaaggacggcggcttcctcacg
tccaactgggagctctacaaatctgaaaaccgcctggtggaattgttcaatcgcgccggc
gtcaagctgcgcctgttccacggccgcggcggcaccgtcggtcgcggcggcggcccgagc
tatcaggccatcctggcgcaaccgccgggcacggtcaacggccagatccgcctgaccgag
caaggtgaaatcattgcgtccaagttctccaacccggagatcggccgccgtaatctggag
ttgctggtcgccgcgacgctggaagccagcctcatgccggaaaccaccgacgccaaagag
acccgcaagctggccgagtttgagcgcgtgatggaagatctgtcggaacgcgcctatcag
gcctaccgcaacctggtctacgaaacaccgggcttcacggactacttctttgcctcgacg
ccgattgcagaaatcgccgaactcaacattggttcgcgccctgcttcgcgcaaatcgact
cgccgcatcgaagacctgcgcgcgattccatggggcttctcgtggggtcaatgccgtttg
ctgttcccgggctggtatggcttcggcagcgcggtgtcggagtggctgcaggaaggcggc
accaaagagagcgccaagaaactggcggccctgcgcgcgatgtacaaagaatggccgttc
ttcgccgccctgctgtcgaacatggacatggtcttgtccaagaccgatctggccgtcgcc
tcgcgctacgccggactggtcgcggaccgcaagctgcgcaccgcgatcttcggacgcatc
gtgagcgagcatgagcgtaccagtcacctgctcagctcgatcacgggcaacaaggatcgc
ctggccggtaatccgctgctggcgcgttcgatcaagaaccgctttgcctatctagacccg
ctgaatcacttgcaagtcgagctgatcaagcgccatcgcagcacggccgcagcaggcaag
aaagtcgaggaacgcgtgcaacgcggaatacacctgaccatcaacggcgtggctgccggt
ctgcgcaatacgggctga

DBGET integrated database retrieval system