Homo sapiens (human): 4489 Help Entry 4489              CDS       T01001                                  Symbol MT1A, MT-1A, MT-IA, MT1, MT1S, MTC Name (RefSeq) metallothionein 1A   KO K14739   metallothionein 1/2 Organism hsa  Homo sapiens (human) Pathway hsa04978   Mineral absorption Brite KEGG Orthology (KO) [BR:hsa00001]  09150 Organismal Systems   09154 Digestive system    04978 Mineral absorption     4489 (MT1A)  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03019 Messenger RNA biogenesis [BR:hsa03019]     4489 (MT1A)    03029 Mitochondrial biogenesis [BR:hsa03029]     4489 (MT1A) Messenger RNA biogenesis [BR:hsa03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      4489 (MT1A) Mitochondrial biogenesis [BR:hsa03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     4489 (MT1A) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Metallothio Motif Other DBs NCBI-GeneID:  4489 NCBI-ProteinID:  NP_005937 OMIM:  156350 HGNC:  7393 Ensembl:  ENSG00000205362 UniProt:  P04731 LinkDB All DBs Position 16:56638666..56640087 Genome browser AA seq 61 aa AA seqDB search MDPNCSCATGGSCTCTGSCKCKECKCTSCKKSCCSCCPMSCAKCAQGCICKGASEKCSCC A NT seq 186 nt NT seq  +upstreamnt  +downstreamnt atggaccccaactgctcctgcgccactggtggctcctgcacctgcactggctcctgcaaa tgcaaagagtgcaaatgcacctcctgcaagaagagctgctgctcctgctgccccatgagc tgtgccaagtgtgcccagggctgcatctgcaaaggggcatcagagaagtgcagctgctgt gcctga

DBGET integrated database retrieval system