KEGG   Homo sapiens (human): 4567Help
Entry
4567              tRNA      T01001                                 

Gene name
TRNL1, MTTL1, MT-TL1
Definition
tRNA-Leu
Orthology
K14228  
tRNA Leu
Organism
hsa  Homo sapiens (human)
Pathway
Aminoacyl-tRNA biosynthesis
Disease
H00810  
Progressive myoclonic epilepsy (PME)
H01347  
MELAS Syndrome
H01356  
Myoclonic Epilepsy and Ragged-Red Fiber Disease
Class
Genetic Information Processing; Translation; Aminoacyl-tRNA biosynthesis [PATH:hsa00970]
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
OMIM: 
HGNC: 
LinkDB All DBs
Position
MT
NT seq 75 nt NT seq  +upstreamnt  +downstreamnt
gttaagatggcagagcccggtaatcgcataaaacttaaaactttacagtcagaggttcaa
ttcctcttcttaaca

DBGET integrated database retrieval system