KEGG   Magnetospirillum sp. ME-1: WV31_19480Help
Entry
WV31_19480        CDS       T04817                                 

Definition
(GenBank) alanine racemase
  KO
K01775  
alanine racemase [EC:5.1.1.1]
Organism
magn  Magnetospirillum sp. ME-1
Pathway
D-Alanine metabolism
Metabolic pathways
Vancomycin resistance
Brite
KEGG Orthology (KO) [BR:magn00001]
 Metabolism
  Metabolism of other amino acids
   00473 D-Alanine metabolism
    WV31_19480
 Human Diseases
  Drug resistance
   01502 Vancomycin resistance
    WV31_19480
Enzymes [BR:magn01000]
 5. Isomerases
  5.1  Racemases and epimerases
   5.1.1  Acting on amino acids and derivatives
    5.1.1.1  alanine racemase
     WV31_19480
Peptidoglycan biosynthesis and degradation proteins [BR:magn01011]
 Precursor biosynthesis
  Racemase
   WV31_19480
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
LinkDB All DBs
Position
4223388..4224503
Genome map
AA seq 371 aa AA seqDB search
MTDLSRATALLTIDVAAIVANWKRLSALVAPAEASAVVKADCYGLGVEHIAPALFAAGCR
SFFVACVDEGIVLRRIVPGAVIHVLSGPTGGDEAEFAVHNLIPVLNSLAQITGWASFAKK
GSGAPAVAIHIDTGMNRLGLSEPELERLAAKPEILAAMRPILVMSHLACADDSDSPMNAK
QLTSLRRLASHLPALPQSMAASSGIFLGRGFHLAMVRPGAALYGLNPMPGRPNPMSQVVK
LQGKILQVRDVDSPMTVGYGATHRVEGKRRLAVVAVGYADGWFRSLSNRGHGMIGGMKVP
VVGRVSMDLTTFDVTDVPVEHAHPGGLIELIGPGHGADHVAAEADTIGYEVLTALGRRHH
RRWTGTEGATA
NT seq 1116 nt NT seq  +upstreamnt  +downstreamnt
atgaccgacctgtcccgcgccaccgccctgctgaccatcgacgtggcggccatcgtcgcc
aactggaagcggctgtccgccctggtggcgccggccgaggcgtcggccgtggtcaaggcc
gattgctacggcttgggggtggagcacatcgcccccgccttgttcgccgccggatgccgg
tcgttcttcgtcgcctgcgtggacgagggcatcgtgctgcgccgcatcgtgcccggcgcg
gtgatccatgtgctgagcggccccaccggcggcgacgaggctgaattcgccgtccacaac
ctgattccggtgctgaactcgctcgcccagatcaccggctgggccagcttcgccaagaag
ggcagcggtgcgcccgccgtggccatccacatcgataccggcatgaaccgcctgggcctg
tccgagcccgagttggagcgtctggccgccaagcccgagattctggccgccatgcgcccc
atcctggtcatgagccacctggcctgcgccgacgacagcgattcgcccatgaacgccaaa
caattgacctcgttgcgccggctggcctcgcatctgccagccctgccccagtccatggcg
gcctcctcgggtatcttcctgggacggggctttcacctcgccatggtccgcccgggcgcc
gcgctctatggcctcaatcccatgccgggtcgccccaatcccatgagccaagtggttaaa
ctgcaaggaaaaatccttcaggtccgtgacgttgacagccctatgaccgttggctatggt
gccacccaccgcgtcgagggaaagcgcaggctggcggtcgtggcggtgggctatgccgac
ggctggttccgctccctctcgaatcgcgggcatgggatgatcggggggatgaaggtgccg
gtggtcggacgggtttccatggatttgaccaccttcgacgtcaccgacgtcccggtggag
cacgcccatcccggcgggctgatcgaattgatcggccccggccatggcgccgaccacgtg
gcggccgaggccgacaccatcggctacgaggtcctgaccgccctgggccgccgccatcac
cgccgctggaccggcaccgagggggcgacggcgtaa

DBGET integrated database retrieval system