KEGG   Methylocystis bryophila: B1812_03805Help
Entry
B1812_03805       CDS       T04837                                 

Definition
(GenBank) acyl-phosphate glycerol 3-phosphate acyltransferase
Organism
mbry  Methylocystis bryophila
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
LinkDB All DBs
Position
835635..838520
Genome map
AA seq 961 aa AA seqDB search
MTSPAKQEPPESEASPRPPEEDVGAQVVDIVRALVAELHPTLVDARRVRLDSDLDRDLAL
DSLSRAELLMRLGRHFKTELPEGLLGGARTPQDLANAVAEAAPSLVQRLVRAQQEPPPLE
AVQEPIEAETLIEALASHAQRNGQRAHVLLWKGADRRESLTYGELYREACAAAGGLIERE
IEAGDRVAIMLPTSRDFFVAFFGVLFAGAIPVPIYPPFRLATIEDHLHRQAGILNNAGAS
ALITNREIRIVGGLLSGLAPCLRHIATIADLAKAAPLAAPLPATSASTALIQYTSGSTGD
PKGVVLSHGNLLANIRAMGAVVKATSADRVVSWLPLYHDMGLIGCWLGSLYYGAPALIMS
PLSFLVDPARWLWAIHGHKGTISAAPNFAFEFCLKAIDDAAISGLDLSSLRIVVNGAEPV
SPATLERFVEKYAKFGFRPEMMAPVYGLAENAVGLAFPPVGRSPLIERVDRSALDREGVA
RRVEKDGAKAVAFVACGQPLPHNEIRVIDDHGRELPERHEGRLQFKGPSATKGYFQNPEK
SKALFDGDWLETGDRGYIAGGDIFITGRIKDLIKRGGRNIYPQELEEAVGLLEGVRKGCV
AVFPSVDRRAGTERLIVMAETRVTEASAREALRQAIVEKSQAVLDLAPDEIVLVAPHTAP
KTSSGKIRRSAARAMFEAGALEGARSSPTWQLLRLGLSGAGPRLRRALSNLGALIYGAYV
WCGLLLTAAWVLPCVLLLPKPSWRHSALHGGARGFFRLSGMPLSVEEEAPLPEANAIIVA
NHSSYLDGAVMAAVCPGKIAFVAKEELARQPVAGAFLRRLGAIFVRRTDPAGGVADARAA
LELARAGARVVWFPEGTFSRMPGLMEFHVGAFLTAAQLGLPVIPVTIRGTRSILRADSWL
PRRGAIRVHVGAPIAPTGGDFEAALALRQAVRAQILARCGEPDLAHERVVVPPDRRDRGG
E
NT seq 2886 nt NT seq  +upstreamnt  +downstreamnt
ttgacgagccccgcgaaacaagaaccgccagaatcggaagccagcccaaggccgccggag
gaggatgtcggcgcgcaggtcgtcgatatcgttcgagcgcttgttgcggagcttcacccc
acgctcgtcgatgcgcggcgtgtgcgtttggacagcgatctcgaccgcgatctcgcgctc
gacagcctttcccgcgccgagttgctcatgcggttgggccgccatttcaaaaccgagctt
cctgaaggtcttctcggcggggcccgcacccctcaagacctcgccaacgccgtcgcggaa
gcggctccttcgctcgtccaaaggcttgtccgagcgcagcaggagccgccgccgctcgaa
gccgtacaggagccgatcgaagcggagactctgatcgaggcgctggcgtcgcacgcgcag
cgaaacggccagcgcgcgcacgtgctcttatggaagggcgccgatcgccgcgagtccttg
acctatggcgagctttaccgtgaggcctgcgctgcggcgggcgggctcatcgagcgcgag
atcgaggcgggcgaccgtgtcgccatcatgctgccgacaagccgcgacttcttcgtcgcc
ttcttcggcgttctcttcgccggcgccattcccgttccgatctacccgccgttccgcttg
gcgacaatcgaggatcatctccaccgccaagccggcattctgaacaacgctggggcctcc
gcgctgatcacgaacagggagattcgtatcgtcggcggcctcttgtccggccttgcgccg
tgcctgcgccacattgcgacgatcgccgatctggcgaaagccgcgccgctcgccgccccg
ctgcccgcgacctcggcgtccaccgcgctcattcaatatacgtcggggagcacgggcgat
ccgaagggcgtcgtgctctcgcacggcaatctgctcgccaacatccgcgccatgggggct
gtcgtgaaagctacgtcggccgacagggtcgtgagctggctgccgctttatcacgacatg
ggtctgatcggttgttggctcggcagtctctattatggcgcgccggctctgatcatgtcg
ccgctctcgtttctcgtcgatccggcgcgctggctctgggcgatccacgggcacaaggga
acgatttccgcggctcccaacttcgcctttgaattctgcctcaaggcgatcgacgacgcg
gccatttctgggctcgacctctcttcgctgcgcatcgtcgtcaacggagccgagcccgtc
agccccgccacgcttgaacgcttcgtcgaaaaatacgccaaattcggctttcggccagag
atgatggctcccgtctacggccttgcggaaaatgcggtcgggctcgcttttccgcccgtc
ggcaggtctccgctcatcgagcgcgtcgaccgaagcgccttggatcgggagggtgtggcg
cgcagggtggaaaaagacggcgccaaggccgtggctttcgtcgcctgcggtcagcccctg
cctcacaatgagattcgcgtcatcgacgaccacggccgcgaattgccggagcgccacgaa
gggcggctgcaattcaagggcccgtcggcgacgaagggctattttcaaaaccccgagaag
tcgaaagcgcttttcgacggcgattggctggagacgggcgatcgcggctacatcgccggc
ggcgacatcttcatcacgggacgcatcaaggatctcatcaagcgcggggggcgcaacatc
tacccgcaggagctcgaggaagctgtgggtttgctcgaaggcgttcgaaaaggctgcgtt
gcggtgttcccctcggtcgatcgtcgcgccggaaccgaacggctgatcgtgatggccgag
acgcgcgtaacggaggccagtgcgcgcgaagcgctgcgccaagccatcgtcgagaaatcg
caggctgtgctcgatctcgcgcccgacgaaatcgtgctcgtcgcgccgcacacggcgccg
aagacatcgagcggaaagatacgccgctccgccgcacgcgcgatgttcgaggccggcgcg
ctggaaggcgcgcgctcgagtccaacgtggcaactcctgcgccttgggctctccggcgca
gggccgcgattacgccgagctctgtcgaatctgggcgcgctcatctatggcgcctatgtc
tggtgcgggttgcttttgaccgccgcctgggttttgccatgcgtgctgctgctcccgaag
ccgagctggcgacattccgcgctgcatgggggagcacgaggcttttttcgtctcagcggc
atgcccttgagcgtcgaggaagaggctcctcttcccgaggcgaacgcgatcatcgtcgcg
aaccactcgagctacctcgacggcgctgtgatggccgccgtttgtcccggaaagattgcc
ttcgtggcgaaggaggagctggcgcggcaacccgtcgccggcgccttcctgcggcggctc
ggcgcgatttttgtgcgccggaccgatccggcgggcggcgtcgccgacgccagggcggct
ttggagctggcgcgcgccggagcccgcgtcgtttggtttcccgaaggcacgttctcacgg
atgccgggtctgatggagttccacgtcggcgcgttcttgaccgccgcacagctcggccta
ccggtcattcccgtgacgatccgcggaacccgctcgatcctgcgcgcagactcctggctg
ccgcgacgaggcgcgatacgcgtgcatgtcggggcgccgattgcgccgacgggcggagac
ttcgaggctgccctggctctgcggcaggctgtccgcgcccagatactcgcccgatgcggc
gagccggatttggcgcatgaacgggtagtggtccctccggatcggcgcgatcgcggcggc
gaatag

DBGET integrated database retrieval system