KEGG   Methylobacterium phyllosphaerae: MCBMB27_01826Help
Entry
MCBMB27_01826     CDS       T04968                                 

Definition
(GenBank) elongation factor Tu 1
  KO
K02358  
elongation factor Tu
Organism
mphy  Methylobacterium phyllosphaerae
Brite
Translation factors [BR:mphy03012]
 Eukaryotic Type
  Elongation factors
   MCBMB27_01826
 Prokaryotic Type
   MCBMB27_01826
Mitochondrial biogenesis [BR:mphy03029]
 Mitochondrial DNA transcription, translation, and replication factors
  Mitochondrial transcription and translation factors
   Mitochondrial translation factors
    MCBMB27_01826
Exosome [BR:mphy04147]
 Exosomal proteins
  Exosomal proteins of haemopoietic cells  (B-cell, T-cell, DC-cell, reticulocyte, and mast cell)
   MCBMB27_01826
  Exosomal proteins of breast cancer cells
   MCBMB27_01826
  Exosomal proteins of colorectal cancer cells
   MCBMB27_01826
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
LinkDB All DBs
Position
1962999..1964189
Genome map
AA seq 396 aa AA seqDB search
MGKEKFSRTKPHCNIGTIGHVDHGKTSLTAAITKVLAETGGATFTAYDQIDKAPEEKARG
ITISTAHVEYETQNRHYAHVDCPGHADYVKNMITGAAQMDGAILVVSAADGPMPQTREHI
LLARQVGVPALVVFLNKVDMVDDEELLELVELEVRELLSKYDFPGDDIPITKGSALMALE
DKEPKIGKEAVLALMATVDAYIPQPERPIDLPFLMPIEDVFSISGRGTVVTGRVERGIVK
VGETVEIVGIRDTQTTTVTGVEMFRKLLDQGQAGDNVGVLLRGTKREDVERGQVVCKPGS
VKPHAKFKAEAYILTKEEGGRHTPFFTNYRPQFYFRTTDVTGIVTLPEGTEMVMPGDNVT
MDVALIVPVAMEEKLRFAIREGGRTVGAGVVAAIND
NT seq 1191 nt NT seq  +upstreamnt  +downstreamnt
atgggcaaggaaaagttctcccgcaccaagccgcactgcaacattggcacgattggtcac
gttgaccacggcaagacgtcgttgacggcggcgatcacgaaggttctggcggagacgggc
ggggcgacgttcacggcctacgaccagatcgacaaggctccggaggagaaggcgcgcggg
atcacgatttcgacggcgcacgtggagtacgagacgcagaaccgtcactacgcgcacgtg
gattgccccgggcacgccgactacgtgaagaacatgatcacgggcgcggcgcagatggac
ggcgcgatcctggtggtttcggcggccgacggcccgatgccgcagacccgcgagcacatc
cttctggcgcgccaggtcggcgttccggcgctggtggtgttcctcaacaaggtcgacatg
gtcgacgacgaggagctcctggagctggtcgagctggaggtgcgcgagctcctgtcgaag
tacgacttccccggcgacgacatcccgatcaccaagggctcggcgctgatggcgcttgag
gacaaggagccgaagatcggcaaggaggcggtgctggcgctgatggcgacggtggatgcc
tacatcccgcagccggagcgtccgatcgacctgccgttcctgatgccgatcgaggacgtg
ttctcgatctcgggccgcggcacggtggtgacgggtcgcgtcgagcgcggcatcgtcaag
gtcggcgagacggtggagatcgtcggcatccgcgacacgcagaccacgacggtcacgggc
gtggagatgttccgcaagctgctcgaccagggccaggcgggcgacaacgtcggcgtgctg
ctgcgcggcacgaagcgcgaggacgtggagcgcggccaggtcgtgtgcaagccaggttcg
gtgaagccgcacgccaagttcaaggccgaggcctacatcctgaccaaggaagagggcggc
cgccacacgccgttcttcaccaactaccggccgcagttctacttccggaccaccgacgtg
accgggatcgtgacgctgcccgagggcaccgagatggtgatgccgggcgacaacgtgacc
atggacgtggcgctgatcgtgccggtggccatggaggagaagctgcgcttcgccatccgc
gagggcggccgcaccgtcggtgccggcgtcgtcgccgccatcaacgattga

DBGET integrated database retrieval system