KEGG   Methylobacterium phyllosphaerae: MCBMB27_04283Help
Entry
MCBMB27_04283     CDS       T04968                                 

Definition
(GenBank) alanine racemase, catabolic
  KO
K01775  
alanine racemase [EC:5.1.1.1]
Organism
mphy  Methylobacterium phyllosphaerae
Pathway
D-Alanine metabolism
Metabolic pathways
Vancomycin resistance
Brite
KEGG Orthology (KO) [BR:mphy00001]
 Metabolism
  Metabolism of other amino acids
   00473 D-Alanine metabolism
    MCBMB27_04283
 Human Diseases
  Drug resistance
   01502 Vancomycin resistance
    MCBMB27_04283
Enzymes [BR:mphy01000]
 5. Isomerases
  5.1  Racemases and epimerases
   5.1.1  Acting on amino acids and derivatives
    5.1.1.1  alanine racemase
     MCBMB27_04283
Peptidoglycan biosynthesis and degradation proteins [BR:mphy01011]
 Precursor biosynthesis
  Racemase
   MCBMB27_04283
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
LinkDB All DBs
Position
complement(4595341..4596474)
Genome map
AA seq 377 aa AA seqDB search
MSRIDRDHRPDAGPAGTAAALLTIDLGAIADNYRALALHAGPAVCAAVVKADAYGLGAER
VAPVLAAAGCRHFFVAQVGEGVALRAILGPGPVIAVLNGASPGSEAACAAHDLVPVLNDR
SQRDGWQGLARRLDRRLPAILQIDSGMARFGFAPDEACALLDAPDALAGLDLRLVMSHLA
CAGEPDSPVNAAQRAVFEVVRRRLPAVPASLAASSGIFLGPDFRFDLVRPGAALYGIAPQ
ADAPNPMRPVIGLRARVMQTRSVPAGTPVGYGHAAKVGRDSRLATVAIGYADGFFRSTAG
GAAWFGGTRLPVVGRVSMDSLVLDVTDLAPGTIGPGALVDIIGPERDVDAVAAAAGTIGY
EVLTNLGHRFHRVYLGA
NT seq 1134 nt NT seq  +upstreamnt  +downstreamnt
atgagcaggatcgatcgcgatcaccggcccgatgccggtcccgcaggcaccgcggccgcg
ctcctgacgatcgacctcggggccatcgccgacaattaccgtgccctcgcgttgcatgcc
gggccggccgtctgcgcggcggtggtcaaggcggacgcctacgggctcggcgccgagcgg
gtggcgccggtcctggccgccgccggctgtcggcatttcttcgtggcgcaggtcggcgag
ggcgtcgccctccgggcgatcctcggccccggccccgtgatcgccgtgctcaacggcgcc
tccccgggcagcgaggcggcctgcgcggcccacgacctcgtccccgtcctcaacgaccgg
tcgcagcgcgacggctggcagggtctcgcccggcgcctggaccggcgcctgcccgcgatc
ctccagatcgattccggcatggcccggttcggcttcgcgccggacgaagcctgcgcgctc
ctcgacgcgccggacgcgctcgcaggcctcgacctgcggctggtgatgagccacctcgcc
tgtgcgggcgagccggacagccccgtcaacgcggcgcagcgcgccgtcttcgaggtcgtc
cggcggcgcctgccggccgtgcccgcgagcctcgcggcctcctccgggatcttcctcggg
ccggacttccggttcgacctggtgcgccccggcgccgccctctacgggatcgccccgcag
gcggacgccccgaatccgatgcggccggtgatcggtctgcgggcgcgggtgatgcagacg
cgcagcgtcccggctgggacccccgtcggctacgggcacgcggcgaaggtcggccgggac
agccgcctcgccaccgtggcgatcggctacgcggacgggttcttccgcagcacggcgggc
ggcgcggcctggttcggcggcacgcgcctgcccgtggtcgggcgggtctcgatggacagc
ctcgtcctggacgtcaccgacctggcccccggcacgatcgggccgggggcgctcgtcgac
atcatcgggccggagcgcgacgtcgacgccgtcgccgcggcggccggcacgatcggctac
gaggtcctgaccaacctcggccaccgcttccaccgcgtctatctcggagcctag

DBGET integrated database retrieval system