KEGG   Methylobacterium phyllosphaerae: MCBMB27_05232Help
Entry
MCBMB27_05232     CDS       T04968                                 

Definition
(GenBank) long-chain-fatty-acid--AMP ligase FadD26
Organism
mphy  Methylobacterium phyllosphaerae
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
LinkDB All DBs
Position
5589224..5592166
Genome map
AA seq 980 aa AA seqDB search
MKIKPPRRDTAYLSCGCGLEPGHFAGIPESFVENVARLPSERFDPVAQPTGAAVLDMVRS
LLLELHPERGATIAVDLDSDLEREFGLDSLGRAELILRLSRSFRVSLPERLIGEAATPAA
LLAAIQAAGAAREPSAASPPPAALPTAAEPHRATTWADVLDFHVRNHPDRPHLRLQQEDG
TETVLTYAALDRRSRQVAAGLLKLDLAFGDRVALMLPTGPDFFPAFLGTILAGGGPVPLY
PPFRRAQIQDHLQRQVGILANAAPQILITDAAIKPFAWLLRDGVESLRVLTTTADLVTED
ALAAAVPATGADLALIQYTSGSTGDPKGVMLTHANLLANVRAMGEAVAASSADVVVSWLP
LYHDMGLIGCWLGSLYYGAPAAILSPLAFLADPGRWLRTIHRQRGTISAAPNFAYELCLK
TLRDEDLAGLDLSSLRVLTNGAEPVSPDTLARFTERFAAFGLRPSAVTPVYGLAECAVGL
TFPPLGRGPRIDWIDRATLSRSGEALPAEPGAPGAVAFAACGHPLRGHQIRIVDEAGREV
PERREGRLQFNGPSATTGYFRRPEITRALFDGAWLESGDLAYLASGDVFVTGRTKDIIIR
AGRKIHPHELEEVAGAVDGVRKGCVAAFASPDPRTGTERLILAAETRLTDAAALEELRRT
LAREAMGVIEQPPDVIVLCPPRTLPKTSSGKIRRAATRSLYAAGELGRPEAALRTQLVRL
VVAGAAARLRRIGRLWSEAAYAASWWGVLVVIGAILWPLVLVLPKRAWRFGALRTGLRVF
FRVTRTPLTVSGEPVSRGAVIVANHASYLDGAVLAAVLPGAPVFLAKQELARQRIAGPFL
RRLGTAFVHRGTAAGIADAAAIVGRIRDGEQVVAFPEGTFTRTPGLLGFHPGAFLDACRA
GAPIVPVAITGTRSALRADQWFPRRSVIHVHIGAPIAPDGEDFHAAIRLRNRARAAILAR
CNEPDLSREAVPSPVEPAPE
NT seq 2943 nt NT seq  +upstreamnt  +downstreamnt
atgaagatcaagccgccgcggcgggacacggcttatctgagttgcggatgcgggttggag
cccggtcatttcgccggcatcccggagtccttcgtggagaacgtcgcgcgcctgccgagc
gagcggttcgatccggtcgcgcagcccaccggagccgctgtcctggacatggtccggtcg
ctcctgctcgaactgcacccggagcggggcgcgacgatcgcggtcgacctcgacagcgac
ctcgaacgggagttcggcctcgacagcctggggcgcgcggagctgatcctgaggctgtcg
cgcagcttccgggtgtcgctgccggagaggctgatcggcgaggcagcgacgccggccgcg
ttgctggccgcgatccaggctgcgggcgccgcgcgcgagccctcggcggcgtccccgcca
ccagccgcgctgccgacggcggccgagccgcaccgggccaccacgtgggcggacgtgctc
gatttccacgtccgcaatcacccggaccgcccccatcttcgattgcaacaggaggacggg
accgagaccgttctgacctacgcggcgctcgaccggcgttcgcgtcaggtcgcggccggc
ctcctgaagctcgatctcgccttcggcgaccgggtcgccctcatgctgcccaccgggccc
gacttcttcccggccttcctcggcacgatcctggcgggtgggggcccggtcccgctctac
ccgccgttccggcgcgcccagatccaggatcacctgcagcgtcaagtcggtatcctggcg
aacgctgcgccgcagatcctgatcaccgatgcggcgatcaaacccttcgcctggctgctg
cgcgacggcgtcgagagtttgcgggtcctgacgaccaccgcggatctcgtgacggaagac
gctctggcggcggccgtcccggccacgggggcggaccttgcgctgatccaatacacctcc
ggcagcacaggcgatccgaagggcgtgatgctgacccacgccaacctgctcgccaatgtc
cgcgccatgggcgaagcggtggcggcctcgtcggcggacgtcgtcgtgagctggctccct
ctctaccacgatatgggattgatcggctgctggctgggcagcctctattacggtgcgccg
gcggcgatcctttcacccctggccttcctggccgatccggggcgctggctcaggacaatc
catcgccagcgcggcacgatctcggccgccccgaacttcgcctacgagctgtgtctcaag
accctgcgggacgaggatctcgcggggctcgatctcagctcgctgcgcgtcctgaccaac
ggggccgaaccggtcagcccggacacgctggcccggttcactgagcgcttcgcggccttc
ggcctccggccgtcggccgtcacacccgtctacgggctcgccgaatgcgcggtcggcctc
acctttccgcccctcggccggggcccgcgcatcgactggatcgaccgcgcaacgctgtcg
cggagcggcgaggccctgccggccgagcctggcgctccgggggccgtcgccttcgccgcc
tgcgggcatccgttgcgcggccatcagatccggatcgtggacgaggccgggcgcgaggtg
ccggagcgccgggaggggcggctgcagttcaacggtccctccgcgacgaccggctacttc
cggcgtccggagatcacgcgcgccctgttcgacggagcttggctcgagagcggcgacctc
gcctatttggcgagcggcgacgtcttcgtgacggggcgtaccaaggacatcatcatccgg
gccggtcggaagatccatccgcacgagctggaagaggtggcgggcgcggtcgacggcgtc
cgaaagggctgtgtcgcggccttcgcgagccccgacccgagaaccgggacggagcggctg
atcctcgccgccgagacgcgcctcaccgacgccgcggccctggaggagctgcgccgcacc
ctggcccgggaagcgatgggcgtgatcgagcagccgcccgacgtgatcgtcctgtgtccg
ccccgcacattgccgaagacgtcgagcgggaagatccgtcgcgcggcgacgcggtcgctc
tacgcggcaggcgaactcggccggccggaagccgccctgcggacgcagctggtccggctc
gtcgtcgcgggggccgcggcgcggctgcgccgtatcgggcggctctggtcagaggcagcc
tacgcggcctcctggtggggcgtcctcgtcgtcatcggtgccatcctatggccgctggtg
ctcgtcctgccgaagcgcgcttggcgcttcggcgccctccggacgggcctgcgtgtcttc
ttccgggtcacgcggacgccgttgaccgtatcgggcgagcccgtcagccgcggcgccgtc
atcgtcgccaaccatgcgagctatctcgacggcgccgtgctggcggccgtgctgcccggg
gcgccggtcttcctcgccaagcaggagctggcccgtcagcgcatcgccgggccgttcctg
cggcggctgggaaccgccttcgtccaccggggtaccgcggcgggtatcgccgatgcggcg
gcgatcgtcgggcgcatccgcgatggcgagcaggtggtcgcgttcccggagggcaccttt
acccggaccccgggcctcctcggcttccaccccggtgcgtttctggatgcctgccgcgcg
ggtgccccgatcgtgccggtcgcgatcacgggcacgcggtcggcgctgcgggccgatcag
tggttcccccggcggagcgtgatccacgtccatatcggagcgccgatcgccccggacggc
gaggatttccacgccgcgatccgcctgcgcaatcgggcgcgcgcggcgattctcgcccgc
tgcaacgagccggacctctcccgggaagcggtgccgtcgcccgtcgagccggctccggaa
tga

DBGET integrated database retrieval system