KEGG   Nostocales cyanobacterium HT-58-2: BZZ01_24310Help
Entry
BZZ01_24310       CDS       T04905                                 

Definition
(GenBank) phosphoenolpyruvate carboxylase
  KO
K01595  
phosphoenolpyruvate carboxylase [EC:4.1.1.31]
Organism
ncn  Nostocales cyanobacterium HT-58-2
Pathway
Pyruvate metabolism
Methane metabolism
Carbon fixation in photosynthetic organisms
Metabolic pathways
Microbial metabolism in diverse environments
Carbon metabolism
Module
CAM (Crassulacean acid metabolism), dark
Brite
KEGG Orthology (KO) [BR:ncn00001]
   00620 Pyruvate metabolism
    BZZ01_24310
  Energy metabolism
   00710 Carbon fixation in photosynthetic organisms
    BZZ01_24310
   00680 Methane metabolism
    BZZ01_24310
Enzymes [BR:ncn01000]
 4. Lyases
  4.1  Carbon-carbon lyases
   4.1.1  Carboxy-lyases
    4.1.1.31  phosphoenolpyruvate carboxylase
     BZZ01_24310
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
LinkDB All DBs
Position
5876227..5879274
Genome map
AA seq 1015 aa AA seqDB search
MSSLLYSFTQAVNIYPASDLFLRHRLQTVEELWESVLRQECGQKMVDLLRQLRDLCSPEG
QAINDQASSVFKLIEQLNINEAIRAARAFALYFQLINIIEQDYEQRQQLIRYEVETESGT
QETLPDFICSSNQEEAENPVNSGLGADLLTKSWQAANSNGKQRGTFANLFPHLFKLNVPP
QQIQRLIAQLDVQLVFTAHPTEIVRHTIRDKQRRVVQLLQQLDVVEKRSTNGGSSWEVEE
VRGQLLEEIRLWWRTDELHQFKPSVLDEVDYALHYFQEVIFDAIPFLYKRFKYALSSTFP
WLEPPRKNFCKFGSWVGADRDGNPSVTPDITWQTACYQRNIVLEKYIKSVKQLISLLSLS
LHWSDILPDLLESLELEQSQLSEVYDQLALRFRQEPYRLKLSYILKRLENTRDRNLALHK
GEILKSENNTPIYRSGAEFLAELRLIERNLTETGLSCRELENLICQVEIFGFNLTHLDIR
QESSRHSDALNEILEYLGVLKVPYNELSEDERVAWLVGELQTRRPLIPAELPFSEKTNDV
IQTLRVVRSLQQEFDENICQTYIISMCRQVSDVLEVLLLAKEAGLYDPGTAIGTIQVIPL
FETVEDLRRSTSVMRKLFALPLYRALLAGGYQAQEDKEDKTPSSPLTPNLQEVMLGYSDS
NKDSGFLSSNWEIHKAQKSLQQVAEEYGVNLRIFHGRGGSVGRGGGPAYEAILAQPGHSI
NGRIKITEQGEVLASKYSLRDLALYNLETITTAVIQASLLRTGFDDIEPWNEIMEELAAR
SRAHYRNLIYEQPDFIDFFHQVTPIEEISQLQISSRPARRPSGKKDLSGLRAIPWVFSWT
QTRFLLPSWYGVGTALQEFLNEEPEEHLKLLRYFCIKWPFFKMVISKAEMTLAKVDLQMA
QQYVQELSKPEDKARFEKVFEQIANEFYLTRNLVLQITGHQRLLDGDPVLQRSVQLRNGT
IVPLGFIQVSLLKRLREARTNVTSGVIHSRYSKGELLRGALLTINGIAAGMRNTG
NT seq 3048 nt NT seq  +upstreamnt  +downstreamnt
atgagttcccttttatactcttttactcaggcagtgaatatctaccccgcctccgattta
tttttgcgtcatcgcttgcaaaccgtggaggaattgtgggagtctgttctgcggcaagaa
tgtggtcagaagatggtagatctgttgcgacaactgcgggatttatgttcgccagaagga
caagcaatcaatgaccaagcttcttctgtatttaagttgatagaacagcttaatatcaac
gaagcaattcgagcagctcgtgcgtttgctttgtatttccagttgattaacatcatagag
caggactacgaacaacggcagcaattaattcgttatgaagtagaaacagaatcaggaact
caagaaaccttaccagatttcatatgttcatctaaccaggaagaagcagaaaatcctgtt
aacagtggacttggtgcagatttgttgacaaagagttggcaagcagctaactccaacggt
aaacagagagggacttttgccaatttatttcctcatttatttaaactaaatgttccacca
cagcaaatacaacgcttgattgcacagttagatgtgcaactcgtgtttacagcgcaccca
acagaaattgtccgtcataccatccgcgataagcagcgacgagtggttcagttgttgcaa
cagttagatgtggtggaaaagcgttctacgaatggtggttcttcctgggaagtcgaggaa
gtgcgaggacaattgctcgaagaaatccgcctgtggtggcgtactgacgagctacaccag
tttaaaccttcggtactcgatgaagtagactatgccttacactacttccaagaagtcata
tttgatgccattcctttcttgtacaaacgcttcaaatatgctctttctagcactttcccc
tggttagaaccacccaggaaaaacttctgtaagtttggctcttgggtaggtgcagataga
gatgggaacccatcggtcacaccagacatcacctggcaaacagcctgttatcagcgcaac
attgtgctggaaaaatacatcaagtcggtgaagcagttgattagcttgttgagcttatcg
ctgcattggagtgatatattaccagacttgctagaatctctggagttagagcagtcccag
ctcagtgaagtgtatgaccaactggctctgcgctttcggcaagaaccctatcggctcaag
ctatcttatatattgaagcggctagaaaatactcgcgatcgcaacctagctttgcataaa
ggagaaatcctcaagagcgagaataatacgcctatctaccgctcaggagcagagttctta
gcagaactgcgtctaattgaacgcaacctgacagaaacaggtttaagctgtagagaatta
gaaaatctgatttgtcaggtagaaatttttggttttaacttaacgcatctagatatccgc
caagaatcatcccgccactcagatgctctcaatgaaattctggagtatttgggagtttta
aaagtcccttacaacgaactctctgaagacgagagagttgcttggcttgttggagaactg
caaacacgccgcccgttaattccagcagaactgccattctctgaaaaaacaaacgatgtg
attcaaactttacgggtggtgcgatcgctacaacaagagtttgatgagaacatctgccaa
acatacattatcagtatgtgtcgccaagtcagtgatgtgctagaagttttgctactagcc
aaggaagccgggctctatgacccaggtactgctattggtacaattcaagtcattcctctg
tttgagacagtagaagacttgcgacgctccacaagcgtcatgcgaaaactgtttgcatta
cccttatatcgcgctttgctagcaggagggtatcaagcacaggaagacaaggaagacaaa
accccctcatccccactcactcccaatttgcaagaagtaatgttggggtattctgacagc
aataaagactctggttttttaagtagtaactgggaaatccacaaagctcaaaaatcacta
cagcaagtcgcagaagaatatggcgtgaatctgcggattttccacggacgaggtggttct
gtgggacgcggtggtggtccagcttatgaggcgattttggctcagcctggtcacagtatc
aatggacggatcaaaattacagaacaaggagaagttctagcttctaaatactccttacgg
gacttagcgctatacaacctggaaactatcaccactgctgtcattcaagctagcttgctg
cgcactgggtttgatgatatagaaccctggaacgaaattatggaagagctagcagcgcga
tcgcgcgctcactaccgcaacctcatctacgaacaacctgattttattgactttttccat
caagtcaccccaattgaggaaattagccagctacaaattagctcccgtcctgctcgtcgt
ccatctggcaagaaagatttaagtggcttgcgggcaattccctgggtattcagttggaca
caaacccgtttcttgctaccttcttggtatggtgttggtacagcgttgcaagaattccta
aacgaagaaccagaagaacatctgaagttactgcgttatttctgtatcaaatggcctttc
ttcaaaatggtgatttctaaggctgaaatgaccttagcaaaagtagacttgcaaatggcg
caacagtatgttcaagaattgtctaaacctgaagacaaagctcgatttgaaaaggttttt
gaacaaatcgctaatgaattttacctgactcggaatttagttttgcaaattactggtcac
caaagacttttggatggcgaccccgtattgcagcgatcagtacagttgcgtaatggtacc
attgtaccgcttgggtttatacaagtttctctcctcaagcgtctgcgcgaagcccgaacg
aatgtgacatccggagtcatccactctcgttatagtaaaggcgagttgctacgaggggca
ttgttaactatcaacggtattgccgcaggcatgagaaatactggttga

DBGET integrated database retrieval system