KEGG   Ochrobactrum sp. A44: CES85_0596Help
Entry
CES85_0596        CDS       T05040                                 

Definition
(GenBank) superoxide dismutase
  KO
K04564  
superoxide dismutase, Fe-Mn family [EC:1.15.1.1]
Organism
och  Ochrobactrum sp. A44
Brite
Enzymes [BR:och01000]
 1. Oxidoreductases
  1.15  Acting on superoxide as acceptor
   1.15.1  Acting on superoxide as acceptor (only sub-subclass identified to date)
    1.15.1.1  superoxide dismutase
     CES85_0596
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
LinkDB All DBs
Position
1:576667..577263
Genome map
AA seq 198 aa AA seqDB search
MAFELPALPYDYDALAPFMSRETLEFHHDKHHQAYVTNGNKLLEGSGLEGKSLEEIVKES
FGKNQALFNNAGQHYNHLHFWKWLKKDGGGKKLPGKLEKAIESDLGGYDKFREDFIAAGV
GQFGSGWAWLSVKNGKLEISKTANGESPLVHGATPILGVDVWEHSYYIDYRNARPKYLEA
FVDSLINWDYVLELYEKA
NT seq 597 nt NT seq  +upstreamnt  +downstreamnt
atggcttttgaactgcccgcccttccgtacgattatgacgcacttgccccgttcatgtcg
cgcgaaacgctcgaattccaccacgacaaacaccatcaggcttacgttaccaacggtaat
aaactgcttgaaggttcaggtcttgaaggcaagagcctcgaagaaatcgtcaaggaaagc
tttggcaagaaccaggcgctcttcaacaatgctggccagcactacaaccatctccatttc
tggaagtggctgaagaaggacggcggcggcaagaagctgccaggcaagctggaaaaggcg
attgaatctgatcttggcggctacgacaagttccgcgaagacttcattgctgccggtgtt
ggtcagttcggttcgggctgggcatggctttcggtcaagaatggcaagctcgaaatctcg
aagactgcaaacggtgaaagcccactcgttcacggcgcaacaccaattcttggcgtcgac
gtatgggagcattcctattacatcgactaccgtaatgcgcgtccgaagtatcttgaagct
tttgtcgatagcctcatcaactgggattacgtgcttgagctgtacgaaaaggcataa

DBGET integrated database retrieval system