KEGG   Oceanisphaera sp. AMac2203: CBP12_11265Help
Entry
CBP12_11265       CDS       T04855                                 

Definition
(GenBank) phosphoenolpyruvate carboxylase
  KO
K01595  
phosphoenolpyruvate carboxylase [EC:4.1.1.31]
Organism
ocm  Oceanisphaera sp. AMac2203
Pathway
Pyruvate metabolism
Methane metabolism
Metabolic pathways
Microbial metabolism in diverse environments
Carbon metabolism
Module
CAM (Crassulacean acid metabolism), dark
Brite
KEGG Orthology (KO) [BR:ocm00001]
 Metabolism
  Overview
   01200 Carbon metabolism
    CBP12_11265
  Carbohydrate metabolism
   00620 Pyruvate metabolism
    CBP12_11265
  Energy metabolism
   00680 Methane metabolism
    CBP12_11265
Enzymes [BR:ocm01000]
 4. Lyases
  4.1  Carbon-carbon lyases
   4.1.1  Carboxy-lyases
    4.1.1.31  phosphoenolpyruvate carboxylase
     CBP12_11265
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
LinkDB All DBs
Position
complement(2457917..2460559)
Genome map
AA seq 880 aa AA seqDB search
MDNHAPLRANVGLLGQLLGEAIKDHLGAEFLDKIETIRQLAKSARQGNEQDETRLIDTLK
QLSDDELLPVARAFSQFLNLANVAEQFHTISRQTQRNAGAGPIHEVLQRLKAAQIEPERI
TAALSELDIDLVLTAHPTEVTRRTFIHKHVQLNDCLAALELDLPSNEHAELIARIEQLIT
QGWHSKEIRSQRPTPVDEARWGFAVIENSLWPALPQFMRQLEQQTQAELGVRLPLDAAPI
RFTSWMGGDRDGNPFVTAQVTEEVLLLGRWVASSLFLSDIQELVSELSMSEASDELILAS
QSLTPSRGESDEPYRALLRKLREDLRETLLHLNAKVQGQNTDARDLITHNEQLRQPLELC
YRSLQACGLGKIADGLLLDVIRKVACFGIHLLKLDIRQDGERHAKALAEITRYLGLGDYS
EWSEADKQAFLLNELASRRPLLPHHWQASADTQEVLATCQVIAQHPPEAFGIYIISMASA
PSDVLAVQLLLKENGVDFALPVAPLFETLDDLNKGAEVIKQLYSLPWYRGYLAGRQYVMI
GYSDSAKDAGMMAAGWAQYSAMEKLVALSEQAQIKLTLFHGRGGSLGRGGGPAHQAILAQ
PPGSTQGGLRVTEQGEMIRFKFGLPKVALDSLALYASAVLEANLLPPPEPEPQWRKIMDT
LSEVSCAHYRALIRDEPDFVPYFRAATPELELGKLPLGSRPAKRKADGGVESLRAIPWIF
AWTQNRLMLPAWLGAHKGLAAVIAEGQESTLLAMNKGWPFFRARLDMLEMVFLKTDISLA
AYYDALLVPDELKPLGKRLRNELRDSMALILQLKEQAELLVSEPWIKESIKLRNPYTDPL
NVLQAELLKRSRQQGDIHPVLDQALMVTIAGIAAGMRNTG
NT seq 2643 nt NT seq  +upstreamnt  +downstreamnt
atggataatcatgcaccactaagggcaaacgttggcctgttggggcaattactgggcgag
gcgattaaagatcatctcggcgcggagtttttagataaaatagaaactattcgccaatta
gctaagtctgcccgtcaaggtaatgagcaagacgaaacccgattaatcgacaccttaaaa
caactaagtgatgacgagctcttgccagtggcgcgcgcctttagccagtttttaaactta
gccaatgtagctgaacaatttcatactatttctcgccaaacgcagcgcaatgccggcgcg
gggccaatacatgaagtattacaacgtcttaaagcggcgcagattgaacctgagcgcatt
acggcagcgctcagcgagctcgatatcgacttagtgctaaccgcacaccccacagaagtt
acccggcgcacttttatccataaacatgtgcaacttaatgactgtttagccgcacttgag
ctcgatttgcccagtaacgaacacgctgagctaatagcgcgtatcgagcagctgatcacc
caaggttggcacagtaaagaaattcgctctcaacgtcccactcccgtagatgaagcacgc
tggggctttgcggttattgaaaatagcctgtggcctgccctgcctcagtttatgcgccaa
ctcgaacaacaaacccaggccgagctaggcgttaggctgccgctggatgcggctcctatt
cgttttacttcttggatgggcggcgatcgcgacggtaacccttttgtcaccgctcaggta
acagaagaagtgttgttattaggacgctgggtggctagttcgttatttttaagtgacatt
caagagctggtttctgagctctctatgtcagaagctagcgatgaacttatattagccagc
caatccctcacaccgagtcgtggagaaagtgatgagccttatcgcgcattgctgcgaaaa
ctgcgcgaagatttacgagaaacactgctgcatttgaatgctaaggtacaaggacaaaat
accgatgcccgagatttaattacccacaacgagcagctgcgccaacctttagagttatgt
tatcgctcactgcaagcttgcggattgggcaaaattgccgatggcttactgctggatgtc
attcgtaaagtggcctgctttggtattcatttacttaaattagatattcgccaagatggc
gagcgccatgcaaaagcactggccgagatcacccgttatttaggattaggtgattacagt
gaatggagcgaagcagataaacaggcttttttactaaatgaattggcctcccgccggcct
ttgctgcctcaccattggcaagccagtgccgacactcaagaagtgctagcaacttgccaa
gttattgctcagcacccgccagaggcctttggcatttatattatttctatggctagcgcg
ccatcggatgtattggcagtacagctattactaaaagaaaatggtgtggactttgcgcta
ccggtggcgcccttatttgaaaccctcgatgacttaaacaagggcgccgaggtcattaag
cagctctatagcttgccttggtatcgtggctacctagcaggtcgccaatacgtgatgatt
ggctattccgactcggcaaaagatgccggcatgatggccgccggctgggcccaatatagc
gctatggaaaaactggtagcattaagtgagcaagcacaaattaagctcactctttttcat
ggtcgaggtggtagcttagggcgcggtggcggcccagctcatcaagcgattttagcgcag
ccgccgggctcaactcagggcggcttaagggtgacggaacaaggggaaatgatccgcttt
aagtttggtttaccaaaagtagcgcttgacagcttagcgctttatgccagtgccgtatta
gaggccaacttattaccaccgcccgagccagagccacaatggcggaaaataatggatacc
ttaagtgaggtgtcgtgtgctcattatcgagcgcttatccgtgacgagccagactttgtg
ccctactttcgcgccgccactccagagttagagctaggcaaactgccgctgggctcacgt
cccgccaagcgaaaagccgatggcggcgtagaaagtttgcgcgccatcccttggattttt
gcctggacacaaaatcgactgatgctccctgcttggctgggagcgcataaaggcctagca
gcagtcattgccgagggtcaagaaagtaccctgctagcgatgaacaaaggctggccattt
tttagagctcggctcgatatgctagaaatggtgtttttaaaaactgatattagcctagcc
gcctattacgatgcactattagtacctgatgagctaaagcctttgggtaagcggttgcgc
aatgagctgcgcgatagcatggcgcttattttacaactgaaagaacaagctgagttatta
gtcagtgaaccttggataaaagagtccattaagctacgtaatccctacacagatccgtta
aatgttttgcaggccgagctattaaaacgctcccgccagcaaggagatattcatccggta
ttagatcaagcactcatggtgaccatcgccggtatcgcggcagggatgcgtaatacggga
tag

DBGET integrated database retrieval system