KEGG   Oleiphilus messinensis: OLMES_0684Help
Entry
OLMES_0684        CDS       T04860                                 

Definition
(GenBank) elongation factor Tu
  KO
K02358  
elongation factor Tu
Organism
ome  Oleiphilus messinensis
Brite
Translation factors [BR:ome03012]
 Eukaryotic Type
  Elongation factors
   OLMES_0684
 Prokaryotic Type
   OLMES_0684
Mitochondrial biogenesis [BR:ome03029]
 Mitochondrial DNA transcription, translation, and replication factors
  Mitochondrial transcription and translation factors
   Mitochondrial translation factors
    OLMES_0684
Exosome [BR:ome04147]
 Exosomal proteins
  Exosomal proteins of haemopoietic cells  (B-cell, T-cell, DC-cell, reticulocyte, and mast cell)
   OLMES_0684
  Exosomal proteins of breast cancer cells
   OLMES_0684
  Exosomal proteins of colorectal cancer cells
   OLMES_0684
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
LinkDB All DBs
Position
744783..745976
Genome map
AA seq 397 aa AA seqDB search
MAKEKFERTKPHVNVGTIGHVDHGKTTLTAALTRVCAEVWGGEAIAFDGIDNAPEERERG
ITIATSHVEYDSPTRHYAHVDCPGHADYVKNMITGAAQMDGAILVCSAADGPMPQTREHI
LLSRQVGVPYIVVFLNKADMVDDEELLELVEMEVRELLDQYEFPGDDTPIIIGSALMALE
GKDDNGMGTSAVKKLVETLDEYIPEPERAVDQAFLMPIEDVFSISGRGTVVTGRVERGII
RVGEEIEIVGIKDTTKTTCTGVEMFRKLLDEGRAGENVGVLLRGTKRDEVERGQVLAKPG
TINPHTKFESEVYVLSKDEGGRHTPFFKGYRPQFYFRTTDVTGSCELPEGVEMVMPGDNV
RMVVTLIAPIAMEDGLRFAIREGGRTVGAGVVSKIIE
NT seq 1194 nt NT seq  +upstreamnt  +downstreamnt
gtggcaaaagaaaaatttgaacgcaccaaaccgcatgtaaacgttggaactatcggtcac
gtagaccatggtaaaacaactttgactgcagctttgactcgtgtttgtgcggaagtttgg
ggtggtgaagcgatagcatttgacggtatcgataacgcgcctgaagaaagagagcgtggt
attaccatcgcaacttctcacgtagagtatgattctcctactcgtcactacgcgcacgta
gactgccctggacacgcggattatgttaaaaacatgatcactggtgcggctcagatggat
ggtgctatcctggtatgttccgcggctgacggccctatgcctcagactcgtgagcacatc
ctgctgtctcgacaggttggtgtaccgtacatcgttgtgttcctgaacaaagctgacatg
gtagacgatgaagagttgttggagttggtagaaatggaagttcgtgagctgttggatcag
tacgaatttcctggagacgacactccaatcatcatcggttctgcattgatggcgttggaa
ggtaaagatgataacggcatgggtacttctgctgttaagaagctggttgagactcttgat
gagtacattccagagccagagcgtgcagttgatcaagcgttcctgatgccaatcgaagat
gttttctctatctctggtcgtggtactgttgttaccggtcgtgtagagcgtggtatcatt
cgagttggtgaagagatcgaaattgttggtatcaaagatactaccaaaacgacctgtact
ggtgttgagatgttccgtaagctgcttgacgaaggtcgtgcaggtgagaacgttggtgtt
ttgttgcgtggtactaagcgtgatgaagttgagcgtggccaggttctggctaagccagga
accatcaatcctcacactaaattcgaaagtgaagtttatgtgttgagcaaagatgaaggt
ggtcgtcatactccattcttcaaaggctatcgtccacagttctacttccgtactactgat
gtgactggttcttgtgaactgccagaaggtgtggaaatggtaatgccaggggacaacgtt
cgaatggttgttactctgattgcgcctatcgcaatggaagatggtctgcgcttcgcgatt
cgtgaaggtggccgtaccgttggtgctggtgttgttagtaaaatcatcgaataa

DBGET integrated database retrieval system