KEGG   Pseudomonas antarctica: A7J50_5252Help
Entry
A7J50_5252        CDS       T04830                                 

Definition
(GenBank) Elongation factor Tu
  KO
K02358  
elongation factor Tu
Organism
panr  Pseudomonas antarctica
Brite
Translation factors [BR:panr03012]
 Eukaryotic Type
  Elongation factors
   A7J50_5252
 Prokaryotic Type
   A7J50_5252
Mitochondrial biogenesis [BR:panr03029]
 Mitochondrial DNA transcription, translation, and replication factors
  Mitochondrial transcription and translation factors
   Mitochondrial translation factors
    A7J50_5252
Exosome [BR:panr04147]
 Exosomal proteins
  Exosomal proteins of haemopoietic cells  (B-cell, T-cell, DC-cell, reticulocyte, and mast cell)
   A7J50_5252
  Exosomal proteins of breast cancer cells
   A7J50_5252
  Exosomal proteins of colorectal cancer cells
   A7J50_5252
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
LinkDB All DBs
Position
complement(5766784..5767977)
Genome map
AA seq 397 aa AA seqDB search
MAKEKFDRSLPHVNVGTIGHVDHGKTTLTAALTRVCSEVFGSAIVDFDKIDSAPEEKARG
ITINTAHVEYNSLIRHYAHVDCPGHADYVKNMITGAAQMDGAILVCSAADGPMPQTREHI
LLSRQVGVPYIVVYLNKADLVDDAELLELVEMEVRDLLSTYDFPGDDTPIIIGSARMALE
GKDDNEMGTTSVRKLVETLDSYIPDPVRVIDKPFLMPIEDVFSISGRGTVVTGRIERGIV
KVQDPLEIVGLRDTTVTTCTGVEMFRKLLDEGRAGENCGVLLRGTKRDDVERGQVLVKPG
SVKPHTKFEAEVYVLSKEEGGRHTPFFKGYRPQFYFRTTDVTGNCELPEGVEMVMPGDNI
KMVVTLIKTIAMEDGLRFAIREGGRTVGAGVVAKIIE
NT seq 1194 nt NT seq  +upstreamnt  +downstreamnt
gtggctaaagaaaaatttgatcgttccctaccgcacgtcaacgttggcaccatcggtcac
gttgaccacggtaaaaccactctgactgctgctctgactcgcgtttgctccgaagtattc
ggttcggcaatcgttgatttcgataaaatcgacagcgcaccagaagaaaaagctcgtggt
atcaccatcaacaccgcgcacgttgaatacaactcgctgatccgtcactacgctcacgtt
gactgcccaggtcacgctgactatgtgaagaacatgatcaccggtgctgcccagatggac
ggcgcgattctggtttgttcggccgctgatggtccgatgccacagacccgtgagcacatc
ctgctgtcccgtcaggttggcgttccgtacatcgtggtttacctgaacaaggctgacctg
gtagacgacgctgagctgctggaactggttgagatggaagtgcgcgatctgctgagcact
tacgacttcccaggtgacgacactccgatcatcatcggttctgctcgtatggctctggaa
ggcaaagacgataacgaaatgggcaccacgtccgttcgtaaattggttgaaactctggac
agctacatcccagatccagttcgtgttatcgacaagccgttcctgatgccaatcgaagac
gtattctcgatctccggtcgtggtactgttgtgactggtcgtatcgagcgcggtatcgtt
aaggttcaagatccactggaaatcgttggtctgcgtgacactactgtcaccacctgcacc
ggtgttgaaatgttccgtaagctgctcgacgaaggtcgtgctggcgagaactgcggcgtt
ctgctgcgtggtaccaagcgtgacgacgttgagcgtggccaggttctggttaagccaggt
tcggttaagccgcacaccaagttcgaagctgaagtgtacgtattgagcaaagaagaaggc
ggtcgtcacactccgttcttcaaaggctaccgtccacagttctacttccgtactactgac
gtgactggtaactgcgagctgccggaaggcgttgaaatggttatgccaggcgacaacatc
aaaatggttgttaccctgatcaaaaccatcgcaatggaagacggtctgcgtttcgctatc
cgcgaaggcggccgtaccgttggtgctggcgttgtagctaaaatcatcgagtaa

DBGET integrated database retrieval system