KEGG   Parabacteroides sp. CT06: CI960_08350Help
Entry
CI960_08350       CDS       T05011                                 

Definition
(GenBank) alpha-amylase
  KO
K01176  
alpha-amylase [EC:3.2.1.1]
Organism
parc  Parabacteroides sp. CT06
Pathway
Starch and sucrose metabolism
Metabolic pathways
Brite
KEGG Orthology (KO) [BR:parc00001]
 Metabolism
  Carbohydrate metabolism
   00500 Starch and sucrose metabolism
    CI960_08350
Enzymes [BR:parc01000]
 3. Hydrolases
  3.2  Glycosylases
   3.2.1  Glycosidases, i.e. enzymes that hydrolyse O- and S-glycosyl compounds
    3.2.1.1  alpha-amylase
     CI960_08350
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
LinkDB All DBs
Position
1921019..1922467
Genome map
AA seq 482 aa AA seqDB search
MENGVMMQYFEWNLPNDGMLWKRLKDDASHLHEIGISAVWIPPAYKGHEQADEGYGTYDL
YDLGEFDQKGTIRTKYGTKQELQEMIEELHRNQIGVYLDAVMNHKAGADYTEWFMAQEVD
PGQRENATSEPHEIEGWTGFDFPGRGNMYSNFKWHWFHFSGTDYDVSRKKEGIFQILGEG
KHWSEGVDDENGNYDYLMFADLDFDNPEVVREMQDWGIWVSNELNLDGMRLDAIKHMNDQ
FIKHFLEAVRADRGEGFYAVGEYWKNDTESLEAYLSQVEYNVDLFDVALHYNLNEASEKG
RDYDLRDLLKGTLVEICPDQAVTFVDNHDSQKNSSLESQVKDWFKPSAYGLILLMKKGYP
CIFYGDYYGVKGKKSPHRKVLDMLLRARKEYAYGEEVDYFDHPNTIGFVRLGDSGHADSG
LALVISNGEDGEKTMSVGENRKGEVWHEITGSVKDTVAIDEEGKGRFLVKGGKLAVWVKV
KA
NT seq 1449 nt NT seq  +upstreamnt  +downstreamnt
atggaaaatggagtaatgatgcagtatttcgaatggaatctgccgaacgatggaatgctg
tggaaacggctgaaggatgacgcctcgcatttacatgagatcgggatcagcgccgtatgg
atcccacccgcttacaaaggccatgagcaagcggacgaggggtatggaacctatgatcta
tatgatttgggggagttcgaccaaaaagggaccatacgcaccaagtatggaactaaacag
gaacttcaagaaatgatcgaggaacttcaccggaaccagattggcgtatatctggatgcc
gtgatgaaccataaggcgggagccgattataccgagtggtttatggcgcaagaggtagat
cctgggcaacgggaaaacgctaccagcgaaccccatgagatagagggatggaccggcttc
gacttcccggggcgtggcaatatgtattctaattttaaatggcattggtttcatttctcc
gggacggactatgatgtgtcccgcaagaaggaaggtatattccagattctgggagaggga
aaacattggagtgagggagtcgatgatgagaatggaaattacgactatctcatgttcgcc
gatctggatttcgataaccctgaagtcgtgcgtgagatgcaggactgggggatctgggta
tcgaacgaactaaacttggacggtatgcgccttgatgcgatcaagcatatgaacgaccag
tttatcaagcattttctggaggcggtgagagcggatcggggagagggtttctacgctgtc
ggggaatattggaaaaacgataccgaatcgttggaggcttacctgtcgcaagtagaatat
aacgtggatttgtttgacgtagccttacattataacttgaatgaggcttccgagaaaggt
cgtgactatgatttacgcgatctattaaaagggaccttggtcgagatatgcccggatcaa
gccgtcaccttcgtggataaccatgattcccagaaaaacagttctttggagtcgcaggta
aaggattggttcaaaccttccgcctacggtttgatcctgttgatgaagaaagggtatccg
tgtatcttttatggggattattatggcgtaaaaggaaagaaatctccccatcgtaaggta
ttggatatgctattgcgtgcccggaaagaatatgcgtacggggaagaggtggattatttt
gatcatccgaacacgattggcttcgtacgcttgggagattcgggacatgctgattcgggc
ttggcgttggttatctcgaacggggaagatggagagaaaacaatgtctgtgggggagaac
cggaaaggcgaggtatggcatgagatcacaggctcggtaaaagataccgtggcgattgat
gaggaagggaaaggccgtttccttgtcaagggaggcaaattggctgtttgggtcaaggtc
aaggcttaa

DBGET integrated database retrieval system