KEGG   Penicillium digitatum: PDIP_62070Help
Entry
PDIP_62070        CDS       T04849                                 

Definition
(RefSeq) Glucokinase GlkA, putative
  KO
K00844  
hexokinase [EC:2.7.1.1]
Organism
pdp  Penicillium digitatum
Pathway
Glycolysis / Gluconeogenesis
Fructose and mannose metabolism
Galactose metabolism
Starch and sucrose metabolism
Amino sugar and nucleotide sugar metabolism
Metabolic pathways
Biosynthesis of secondary metabolites
Biosynthesis of antibiotics
Carbon metabolism
Module
Glycolysis (Embden-Meyerhof pathway), glucose => pyruvate
Nucleotide sugar biosynthesis, glucose => UDP-glucose
Brite
KEGG Orthology (KO) [BR:pdp00001]
 Metabolism
  Carbohydrate metabolism
   00010 Glycolysis / Gluconeogenesis
    PDIP_62070
   00051 Fructose and mannose metabolism
    PDIP_62070
   00052 Galactose metabolism
    PDIP_62070
   00500 Starch and sucrose metabolism
    PDIP_62070
   00520 Amino sugar and nucleotide sugar metabolism
    PDIP_62070
  Biosynthesis of other secondary metabolites
   00524 Neomycin, kanamycin and gentamicin biosynthesis
    PDIP_62070
Enzymes [BR:pdp01000]
 2. Transferases
  2.7  Transferring phosphorus-containing groups
   2.7.1  Phosphotransferases with an alcohol group as acceptor
    2.7.1.1  hexokinase
     PDIP_62070
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
NCBI-ProteinID: 
UniProt: 
LinkDB All DBs
Position
Unknown
AA seq 495 aa AA seqDB search
MSSSLLDQATRIARDFDYPAEKVQRGVAEYIKQSNEGLTQEGTTLSQIPTFVTAVPNGTE
RGLYLAVDLGGTNFRVCSVLLHGDTTFSLTQSKILIPRELMASGTSKDLFLFLARQIESF
LRIHHNEHFEAHQLRRREDYKEEDMFDLGFTFSFPVRQCGINRGTLIRWTKGFNIPDAVG
HDVCALLQSAIDVLNLPVRVAALVNDTVGTLMARSYTSPGKTGTFLGAIFGTGTNGAYLE
KTKNITKLQHMKDAHFDDPTGEMIINAEWGSFDNHMSVLPTTVFDDELDADSNNPGVQMF
EKRVSGMFLGEILRRALLSLHRNTDLGLFKANENSKVVIPEGSMLFRQWGLDTSMLSSVE
ADSSKDLVDVKTALKDHLEIENPSFEECQAVKIIVHAIGKRAARLSAVPLAAILVHTNKL
ETDDIIDIGVDGSLVEFYPNFEGYMREALREVPQVGVAGDKKIRIGISKDGSGVGAALIA
LIANKDNGLEIPREN
NT seq 1488 nt NT seq  +upstreamnt  +downstreamnt
atgtcttcttcattattggaccaggccacgcgcattgcgcgtgacttcgactaccccgcc
gagaaagtgcaacgcggggttgccgagtacatcaagcagtccaacgagggcttgacccaa
gagggcaccaccttgagccaaattcctaccttcgtgactgcagtgccaaatggcacagaa
aggggcctttatttggctgtggatctcggtggcacgaatttccgtgtgtgctcggtcctc
ttgcacggcgatactaccttctccctcactcaatccaagatcctcattcctcgggagttg
atggcctccggcacctcgaaggatctcttcctgttcctggcccgccaaatcgaatcattc
cttcgcattcaccacaatgaacatttcgaggcccaccagcttcgccgacgggaggattac
aaggaagaggacatgttcgatttgggctttaccttcagtttccccgtgcgccagtgtggc
atcaaccgcggaacactgatccgttggaccaagggcttcaacattcctgatgcggttggc
cacgacgtttgcgcgctgcttcagtccgccattgatgttttgaacctgccagtacgtgtg
gctgcacttgtgaacgataccgtcggtactctcatggcccgctcatatacctcgccaggc
aagactggcactttcctgggtgccattttcggaaccggtaccaacggtgcttatctggag
aagaccaagaacatcaccaagctccagcacatgaaggatgcccactttgatgaccccaca
ggcgagatgatcatcaacgctgaatggggtagcttcgacaaccacatgagcgtgttacct
accacggtgttcgatgatgagctcgatgccgatagcaacaaccccggtgtgcagatgttt
gagaagcgtgtttcaggcatgttcttgggtgaaatcttgcgccgtgcgctcctgtctcta
caccgcaacaccgacctgggattgttcaaggccaacgagaattccaaggtcgtcattcca
gaaggatcgatgcttttccgtcaatggggtcttgacaccagcatgctgagttcagtcgag
gctgatagcagcaaggacttggtggatgtgaagaccgcattgaaggatcacctcgaaatt
gagaaccccagctttgaagaatgccaggccgtgaaaatcatagttcacgccattggaaaa
cgtgccgctcgtctgagcgctgttccgttggctgccattctcgtgcacaccaacaaactt
gagactgatgacatcattgacatcggtgtcgatggcagtctcgttgaattctatcccaat
tttgaagggtatatgcgggaggctttgcgtgaagttcctcaggtcggagttgcaggcgac
aagaagatccgcattggtatttccaaggatggcagcggtgttggcgcagctctgattgcg
ctcatcgctaacaaggataatggcctcgaaattccccgcgagaactaa

DBGET integrated database retrieval system