KEGG   Rhinolophus sinicus (Chinese rufous horseshoe bat): 109441121Help
Entry
109441121         CDS       T04863                                 

Definition
(RefSeq) hexokinase-1
  KO
K00844  
hexokinase [EC:2.7.1.1]
Organism
rss  Rhinolophus sinicus (Chinese rufous horseshoe bat)
Pathway
Glycolysis / Gluconeogenesis
Fructose and mannose metabolism
Galactose metabolism
Starch and sucrose metabolism
Amino sugar and nucleotide sugar metabolism
Neomycin, kanamycin and gentamicin biosynthesis
Metabolic pathways
Carbon metabolism
HIF-1 signaling pathway
Insulin signaling pathway
Type II diabetes mellitus
Carbohydrate digestion and absorption
Central carbon metabolism in cancer
Module
Glycolysis (Embden-Meyerhof pathway), glucose => pyruvate
Nucleotide sugar biosynthesis, glucose => UDP-glucose
Brite
KEGG Orthology (KO) [BR:rss00001]
 Metabolism
  Carbohydrate metabolism
   00010 Glycolysis / Gluconeogenesis
    109441121
   00051 Fructose and mannose metabolism
    109441121
   00052 Galactose metabolism
    109441121
   00500 Starch and sucrose metabolism
    109441121
   00520 Amino sugar and nucleotide sugar metabolism
    109441121
  Biosynthesis of other secondary metabolites
   00524 Neomycin, kanamycin and gentamicin biosynthesis
    109441121
 Environmental Information Processing
  Signal transduction
   04066 HIF-1 signaling pathway
    109441121
 Organismal Systems
  Endocrine system
   04910 Insulin signaling pathway
    109441121
  Digestive system
   04973 Carbohydrate digestion and absorption
    109441121
 Human Diseases
  Cancers
   05230 Central carbon metabolism in cancer
    109441121
  Endocrine and metabolic diseases
   04930 Type II diabetes mellitus
    109441121
Enzymes [BR:rss01000]
 2. Transferases
  2.7  Transferring phosphorus-containing groups
   2.7.1  Phosphotransferases with an alcohol group as acceptor
    2.7.1.1  hexokinase
     109441121
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
NCBI-ProteinID: 
LinkDB All DBs
Position
Unknown
AA seq 472 aa AA seqDB search
MQSSGRWARVIEILKVLEEDCATPIAKLRQVADAVTVEMHAGLASEGGSKLKMLISYVDN
LPSGDEHGFFYALDLGGTNFRVMRVLLGGKQNRVVKQEFEEVSIPPHLMTGGSDELFNFI
AEALAKFVSTEGEDFHLQEGRQRELGFTFSFPVRQTSLASGTLIKWTKGFSIEDTVGQDV
VAELVKAMERVGLDMNVTALVNDTVGTLAGGRYYNPDVVAAVILGTGTNAAYVERAHAIP
KWHGLLPKSGEMVINMEWGNFRSSHLPLTEYDHSLDFESLNPGEQILEKIISGMYLGEIL
RRVLLKMAEEAAFFGDSVPPKLRIPFIIRTPNMSAMHGDTSPDLKVVGSKLKDILEVPTT
SLKMRKVVISLCNIIASRGARLSAAGIYGILKKLGRDAPKDGETQKSVIAMDGGLFEHYS
QFSECMESSLKELLGDEASGSVEVIHSNDGSGVGAALLAASHSQYLEDSETS
NT seq 1419 nt NT seq  +upstreamnt  +downstreamnt
atgcagagctccggcagatgggcgcgtgtgattgagatcctcaaagtgctcgaggaggat
tgcgcaacgccaatcgcgaaactgagacaagtggctgatgctgtgaccgttgagatgcac
gccggtctcgcgtccgaaggtggaagcaagcttaagatgctcattagctacgtcgataat
cttccttctggggacgaacatggtttcttttatgcgctggacctaggaggaacaaacttc
cgtgtcatgcgtgtgcttcttggtggcaaacaaaaccgtgttgtcaaacaagaattcgaa
gaagtctcaattcctcctcatttgatgactggcggttcagatgaattgttcaattttatc
gctgaagcacttgcaaagttcgtctctacggaaggcgaggactttcatctccaagagggt
aggcaaagggaattaggtttcaccttctcgtttccggttaggcagacatctttggcctct
ggcactctcatcaagtggacgaaaggcttttccatcgaagatacagttggacaagatgtg
gtcgctgagcttgtgaaagctatggaaagagttggccttgacatgaatgtcacagcgctt
gtcaatgataccgttggaacacttgctggtggtagatactataacccggatgttgttgcc
gctgttattttaggcactggcacaaatgcagcttatgtcgaacgtgcacatgcaattccc
aaatggcacggcttacttcccaaatcaggagaaatggtgatcaacatggagtggggaaac
ttcaggtcatcacatcttccattgacggagtacgaccactcactggatttcgagagtctg
aacccaggtgaacagattcttgagaaaatcatttccggtatgtatttgggagagatcttg
cgtagagttcttctaaaaatggctgaagaggctgctttctttggcgactctgtcccacct
aagctgagaataccattcatcataaggaccccgaacatgtctgctatgcacggcgacact
tctccggatttgaaggttgtcggaagcaagttaaaggacatattggaggtccctacgact
tctctgaagatgagaaaagttgtgatcagtctctgtaacatcatcgctagccgaggagct
cgtctatctgcagccgggatctatggaatcctcaagaaactaggaagagacgcaccgaaa
gatggagaaacacagaaatctgtgatcgccatggacggtggactgttcgagcactacagt
cagttcagtgagtgtatggagagctcattgaaagagttgctcggagatgaagcatcaggg
agcgtagaggtgattcattcgaatgacgggtctggcgttggagccgcactactcgcagcc
tcgcactctcagtacctggaggactctgaaacaagttaa

DBGET integrated database retrieval system