KEGG   Sphingomonas sp. KC8: KC8_15470Help
Entry
KC8_15470         CDS       T04987                                 

Definition
(GenBank) elongation factor Tu
  KO
K02358  
elongation factor Tu
Organism
spkc  Sphingomonas sp. KC8
Brite
Translation factors [BR:spkc03012]
 Eukaryotic Type
  Elongation factors
   KC8_15470
 Prokaryotic Type
   KC8_15470
Mitochondrial biogenesis [BR:spkc03029]
 Mitochondrial DNA transcription, translation, and replication factors
  Mitochondrial transcription and translation factors
   Mitochondrial translation factors
    KC8_15470
Exosome [BR:spkc04147]
 Exosomal proteins
  Exosomal proteins of haemopoietic cells  (B-cell, T-cell, DC-cell, reticulocyte, and mast cell)
   KC8_15470
  Exosomal proteins of breast cancer cells
   KC8_15470
  Exosomal proteins of colorectal cancer cells
   KC8_15470
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
LinkDB All DBs
Position
3218482..3219672
Genome map
AA seq 396 aa AA seqDB search
MAKAKFERTKPHCNIGTIGHVDHGKTSLTAAITKVLAETGGATFTSYDNIDKAPEERERG
ITISTAHVEYETADRHYAHVDCPGHADYVKNMITGAAQMDGAILVVSATDGPMPQTREHI
LLARQVGVPQLVVFLNKVDLVDDPEILELVELEVRELLSKYDFDGDNIPIIPGSAVAALT
DKTPEIGHDAVLKLMAAVDSWIPQPERPLDRPFLMPIEDVFSISGRGTVVTGRVETGIVK
VGEEVEIVGIKDTRKTTVTGVEMFRKLLDQGQAGDNIGALIRGVGREEVERGQVLAKPGT
ITPHTEFSAEVYVLSKDEGGRHTPFFANYRPQFYFRTTDVTGEVTLPEGTEMVMPGDNVS
LGIKLIAPIAMDQGLRFAIREGGRTVGAGVVGTITK
NT seq 1191 nt NT seq  +upstreamnt  +downstreamnt
atggcgaaagctaagttcgagcggactaagccgcactgcaacatcggtaccatcggtcac
gtcgatcacggcaagacctcgctgacggctgcgatcaccaaggtcctcgccgaaaccggc
ggcgcgaccttcaccagctacgacaacatcgacaaggcgccggaagagcgcgagcgcggc
atcaccatctcgaccgcacacgtcgagtatgaaaccgccgaccgccactatgcgcacgtc
gattgcccgggccacgccgattatgtgaagaacatgatcaccggtgcggcgcagatggac
ggcgcgatcctcgtcgtttcggccaccgacggcccgatgccgcagacccgcgagcacatc
ctgctcgcccgccaggtcggcgtgccgcagctcgtcgtgttcctcaacaaggtcgacctt
gttgacgatcccgaaatcctcgagctggtcgaactcgaagttcgcgaactgctctcgaag
tatgacttcgacggcgacaacattccgatcatcccgggttcggccgttgccgcgctgacc
gacaagacgcctgaaatcggccacgacgccgtgctcaagttgatggccgccgtcgacagc
tggatcccgcagccggaacgtccgctcgatcgtccgttcctgatgccgatcgaagacgtg
ttctcgatctcgggccgcggcaccgtcgtcaccggccgtgtcgaaaccggcatcgtcaag
gttggcgaagaagtcgaaatcgtcggcatcaaggacacccgcaagaccaccgtcacgggc
gtcgaaatgttccgcaagctgctcgatcagggccaggctggcgacaacatcggtgcgctg
atccgcggcgtcggccgtgaagaagtcgagcgtggccaggttctggccaagccgggcacg
atcaccccgcacaccgaattctcggccgaagtgtacgtgctgtcgaaggacgaaggtggc
cgtcacacgccgttcttcgccaactatcgcccgcagttctacttccgcacgaccgacgtg
acgggcgaagtgacgctgccggaaggcaccgaaatggtcatgcccggcgacaacgtgtcg
ctcggcatcaagctgatcgctccgatcgccatggaccagggcctgcgcttcgcgatccgc
gaaggtggccgtacggtcggcgccggcgtcgtcggcacgatcaccaagtaa

DBGET integrated database retrieval system