Shewanella sediminis: Ssed_3116 Help Entry Ssed_3116         CDS       T00596                                  Name (GenBank) cyd operon protein YbgT   KO K00424   cytochrome bd-I ubiquinol oxidase subunit X [EC:7.1.1.7] Organism sse  Shewanella sediminis Pathway sse00190   Oxidative phosphorylation sse01100   Metabolic pathways sse02020   Two-component system Module sse_M00153   Cytochrome bd ubiquinol oxidase Brite KEGG Orthology (KO) [BR:sse00001]  09100 Metabolism   09102 Energy metabolism    00190 Oxidative phosphorylation     Ssed_3116  09130 Environmental Information Processing   09132 Signal transduction    02020 Two-component system     Ssed_3116 Enzymes [BR:sse01000]  7. Translocases   7.1  Catalysing the translocation of protons    7.1.1  Linked to oxidoreductase reactions     7.1.1.7  quinol oxidase (electrogenic, proton-motive force generating)      Ssed_3116 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  YbgT_YccB Motif Other DBs NCBI-ProteinID:  ABV37720 UniProt:  A8FXZ7 LinkDB All DBs Position complement(3757120..3757236) Genome browser AA seq 38 aa AA seqDB search MWYFAWILGVLLACSFGIINALWLENTENMDREADKQD NT seq 117 nt NT seq  +upstreamnt  +downstreamnt atgtggtattttgcttggattttaggtgttttgctggcttgttctttcggtattatcaat gcgttatggcttgaaaatactgaaaacatggacagagaagcagataagcaagactaa

DBGET integrated database retrieval system