KEGG   Vibrio shilonii: BSZ05_24155Help
Entry
BSZ05_24155       CDS       T04936                                 

Definition
(GenBank) sialidase
  KO
K01186  
sialidase-1 [EC:3.2.1.18]
Organism
vsh  Vibrio shilonii
Pathway
Other glycan degradation
Sphingolipid metabolism
Brite
KEGG Orthology (KO) [BR:vsh00001]
 Metabolism
  Lipid metabolism
   00600 Sphingolipid metabolism
    BSZ05_24155
  Glycan biosynthesis and metabolism
   00511 Other glycan degradation
    BSZ05_24155
Enzymes [BR:vsh01000]
 3. Hydrolases
  3.2  Glycosylases
   3.2.1  Glycosidases, i.e. enzymes that hydrolyse O- and S-glycosyl compounds
    3.2.1.18  exo-alpha-sialidase
     BSZ05_24155
Bacterial toxins [BR:vsh02042]
 Toxins that damage the extracellular matrix
  Hyaluronidases/Collagenases
   BSZ05_24155
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
LinkDB All DBs
Position
2:complement(1642440..1644785)
Genome map
AA seq 781 aa AA seqDB search
MVFRKNRQAVWLVMAIGTAPLANAELFDYMATTDPVKDQPSEQGWIADHSQSGSGALSTV
DGVTAWVAQGEGGRAQWKTVLSDALKSQATNYGWRLSTEMRVVSGGMITNYYADGSQRVL
PILSINSVGDLVVEFEGRSGTTVLATGAAATDYHKYELVFHPGDNPNASFYFDGQLILDQ
ISPSPTSQNMLVWGNGSTYTDGVSAYKNIEFEVQGDVIFNGPDRIPSLVASTETPGVVTA
FAEKRVGGGDPGSTANTNDIITRVSTDSGVTWNTELNLTEQINANDDYDFSDPRPIYDST
SDSVIVSYVRWPTDAAQNGDKIKSWMPSGVFYSTYDIATSNWLAPVDVTHQVKEQSYQIA
GWGGSELYSKSATLNSNQDWQLNATLRIYDGAANRIQVADGSRAFVVTFAVDPSGQLTAQ
LNGESSPVVVALSSGDVYGFHQYQIAYSAVSNQASLLVDGNTLTSWSGETSSSNLVEFGN
ADSSVDGRIHLQDIALEQSGVTLVSLDAAYLAQQDPASTTTDLEQLGWSKQKSGNTMSFY
GHASVNPGPGHGIQLERQQAIAGSHNGRLIYPAITLDRYFLNVMSVYSDDGGQNWQTGAS
LPLPYRWKSASSLETLEPSESDLVELDNGHLLLTARLDFNKTVSGVNYGPRQQFLSEDGG
KTWAMLSGNNADVFPGISSGTVDASITRFEEADGSRYLLFTNPQGSPSGASNRQDLGLWF
SFDEGNSWKGPIQLVEGASAYSDIYQLDAETAIVIVETNSSNMRILRVPVTLLKQKVLAL
P
NT seq 2346 nt NT seq  +upstreamnt  +downstreamnt
atggtttttaggaaaaaccgacaagcagtttggctcgttatggcaataggtaccgctccg
ctggcaaacgcagagctgtttgattacatggcaacaacggaccccgtcaaagatcagcca
agtgaacaaggctggattgcagatcatagccaaagtggtagtggtgcgctatcaacagta
gatggagtgacagcatgggtcgctcaaggtgaaggcggacgagcacagtggaaaacggtg
ttatctgacgcgttaaagagtcaagcaacgaactacggctggaggttatcgactgaaatg
cgcgtggttagtggcggcatgatcaccaactattacgccgatggcagtcagcgtgtgttg
ccaattttatccataaacagtgttggtgatctggtggtggagtttgaaggtcgaagtggt
actactgtactggcgacaggcgcggcggcaacggactaccataagtacgaattggtcttt
cacccgggggataaccctaatgcgagcttttacttcgatggacagctaattctcgatcag
atatctccttcaccaacgtcacaaaatatgttggtgtggggtaacggctcaacctatacc
gatggtgtctcagcatacaagaatatagagttcgaagtgcaaggcgatgtgattttcaac
ggccccgatcgcataccatctctagttgcgagcacagaaacgcccggtgtggtgacagcc
tttgcagagaaacgagtgggaggaggtgatccaggttcaaccgccaacaccaatgatatt
attactcgcgtctctaccgactcaggggtgacatggaatactgaattgaacttaactgag
cagatcaacgctaacgacgactatgatttctctgatcctcgtcctatttacgattcaacg
tctgatagtgttattgtttcttatgtccgttggccgactgacgccgcgcagaatggcgat
aagatcaagtcatggatgccaagtggggtcttctacagtacctacgatatcgctacttca
aattggctggctccggtggatgtgactcatcaagtgaaggagcaaagctatcaaattgca
ggttggggaggttcagagctctacagtaaatcagccactctaaacagtaatcaggactgg
cagttgaatgccacactacgaatctatgacggtgctgctaaccgaatacaggtggcagat
ggctctcgtgcttttgtggtgacatttgctgtagatccgtcaggacagcttaccgcgcaa
ttaaatggtgagtcttcgcctgttgttgtcgcgctaagtagtggtgatgtgtatggtttt
catcaataccaaattgcctattcagccgtgagtaatcaagcatctctattggtcgatggc
aatactctgactagctggtcaggtgaaacgtcgagtagcaatcttgtggagtttggtaac
gcagacagcagtgttgatggccgaattcatctacaggatatcgctcttgagcaatcaggc
gtgactttggttagcctagatgcggcttatttagctcaacaagatccagcgagtacgacg
actgacctagaacaattaggttggagcaaacagaagtccggcaataccatgagcttttac
ggacatgccagtgtgaaccctggaccaggtcacgggatccagcttgaacgacagcaagcg
attgctggtagccataatggacgcctaatatatcccgctattacattagaccgatacttc
ttaaacgtcatgtctgtgtacagtgacgacggtggtcaaaactggcaaacaggggcaagc
ttaccgcttccttaccgttggaagagtgcgagcagtttggaaacgcttgagccgagtgaa
tcggatctcgttgaactagataatggtcatttgctcttgactgcacgccttgattttaac
aagaccgtaagtggtgttaattacggtccgcgtcaacagttcttgagtgaagatggcggt
aaaacatgggcgatgctcagcggtaacaatgccgatgttttcccaggtataagctctgga
accgtcgacgcttcaattactcgcttcgaagaagcggatggtagtcgatatctgctgttc
accaatccccaaggtagtccgtctggagcgagcaatcgtcaagatttaggtttatggttt
agttttgacgagggcaacagctggaaaggtccaattcaattggtcgaaggagcatcggct
tattccgatatttatcaacttgatgctgaaacagcaattgttattgtagaaaccaatagt
tccaatatgcgtatactgcgagtgcctgtcactttgctaaaacaaaaggtgttggcgctg
ccttaa

DBGET integrated database retrieval system