KEGG   Xanthomonas campestris pv. vesicatoria: XCV0849Help
Entry
XCV0849           CDS       T00288                                 

Definition
(GenBank) putative alpha-amylase (fragment)
  KO
K01176  
alpha-amylase [EC:3.2.1.1]
Organism
xcv  Xanthomonas campestris pv. vesicatoria
Pathway
Starch and sucrose metabolism
Metabolic pathways
Brite
KEGG Orthology (KO) [BR:xcv00001]
 Metabolism
  Carbohydrate metabolism
   00500 Starch and sucrose metabolism
    XCV0849
Enzymes [BR:xcv01000]
 3. Hydrolases
  3.2  Glycosylases
   3.2.1  Glycosidases, i.e. enzymes that hydrolyse O- and S-glycosyl compounds
    3.2.1.1  alpha-amylase
     XCV0849
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
LinkDB All DBs
Position
complement(968717..969595)
Genome map
AA seq 292 aa AA seqDB search
MRNYRICGGGSDPGLPDLVGNDWVVQQQRAYLQALKSIGVTGFRVDAAKHMTFDHLNRVF
DAGIRSGVYVFGEVITGGGTGNGDYDQFLAPYLQSTPHAAYDFPLFNAVRNAFAIGASMQ
QLVDPAASGQALPGNRAVTFAVTHDIPNNAGFRYAILDPVDETLAYAYLIGRNGGMPMIY
TDNNESGDNRWVNAYLREDLRRMIGFHNGVQGTDMQVLSSSSCHILFRRGSLGIVGINKC
GNPVTTTVGMNNSVLYWNADYVDALGSGNVVRISSSSYTFTLPARGARMWRR
NT seq 879 nt NT seq  +upstreamnt  +downstreamnt
gtgcgtaattaccgcatttgcggcggcggcagcgatccaggcctgccggatctcgtgggc
aacgactgggtggtgcagcaacagcgcgcctatctgcaggcgctcaagagcattggcgtg
accggcttccgggtggatgcggccaagcacatgaccttcgaccatctcaaccgcgtcttc
gatgccggcatccgctcgggtgtgtatgtcttcggtgaagtgattaccggcggcggtact
ggcaatggcgattacgaccagttcctggcgccgtatctgcaatccacgccgcatgcagcc
tacgactttccgttgttcaatgcggtgcgcaatgcgttcgcgatcggcgccagcatgcag
cagctggtggaccccgccgcgtccggacaggcattgccgggcaatcgcgccgtgaccttt
gcagtgacccacgacattcccaacaacgccggcttccgctacgcgattctcgacccggtg
gatgagacgctggcctacgcatacctgatcggtcgcaacggcggcatgccgatgatctat
accgacaacaacgaaagcggcgacaaccgctgggtcaacgcctatctccgcgaagacctg
cgccgcatgatcggcttccataacggcgtgcagggcaccgacatgcaggtcttgtcgtcc
agctcctgccatatcctgttccgtcgcggcagcctaggcatcgtgggcatcaataagtgc
ggcaacccggtcaccaccacggtgggaatgaacaacagcgtgttgtactggaatgccgac
tacgtggacgcgttgggctcgggcaacgtggtgcgcatttccagcagctcgtacaccttt
accctgccggcgcgcggggcgcgcatgtggcgccgctga

DBGET integrated database retrieval system