KEGG   Ziziphus jujuba (Chinese jujube): 107432849Help
Entry
107432849         CDS       T04794                                 

Definition
(RefSeq) hexokinase-1-like
  KO
K00844  
hexokinase [EC:2.7.1.1]
Organism
zju  Ziziphus jujuba (Chinese jujube)
Pathway
Glycolysis / Gluconeogenesis
Fructose and mannose metabolism
Galactose metabolism
Starch and sucrose metabolism
Amino sugar and nucleotide sugar metabolism
Metabolic pathways
Biosynthesis of secondary metabolites
Carbon metabolism
Module
Glycolysis (Embden-Meyerhof pathway), glucose => pyruvate
Nucleotide sugar biosynthesis, glucose => UDP-glucose
Brite
KEGG Orthology (KO) [BR:zju00001]
 Metabolism
  Carbohydrate metabolism
   00010 Glycolysis / Gluconeogenesis
    107432849
   00051 Fructose and mannose metabolism
    107432849
   00052 Galactose metabolism
    107432849
   00500 Starch and sucrose metabolism
    107432849
   00520 Amino sugar and nucleotide sugar metabolism
    107432849
  Biosynthesis of other secondary metabolites
   00524 Neomycin, kanamycin and gentamicin biosynthesis
    107432849
Enzymes [BR:zju01000]
 2. Transferases
  2.7  Transferring phosphorus-containing groups
   2.7.1  Phosphotransferases with an alcohol group as acceptor
    2.7.1.1  hexokinase
     107432849
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
NCBI-ProteinID: 
LinkDB All DBs
Position
12
AA seq 498 aa AA seqDB search
MGKLAVGAAVVCAAAVCAAAALVVRHRMKSSGKWTRAMAILREFEEKCRTPTSKLRQVAD
AMDVEMHAGLASEGGSKLKMIISYVDNLPTGDEKGLYYALDLGGTNFRVLRVQLGGKDAR
VVKQEFEEVSIPPHLMTGTSDALFGYIAEALAKFVAEEGEGFHPAPGRQRELGFTFSFPV
RQTSIASGNLIKWTKGFSIEDTVGQDVVGELTKAMERIGLDMRVAALVNDTIGTLAGGKY
HNQDVIAAVILGTGTNAAYVERAQAIPKWHGLLPKSGEMVINMEWGNFRSSHLPLTDYDQ
ELDNESLNPGEQIFEKMISGMYLGDIVRRVLYKMAEEAAFFGDTVPPKLKIPFILRTPNM
SAMHHDTSPDLRVVGDKLRDILEIPNTSLKVRKVVVELCDIVATRGARLSAAGIVGILKK
IGRDTVREGEKQRSVIALDGGLYEHYTKFSTCMESTLKELLGEEVAANILIEHSNDGSGI
GAALLAASHSQYLEVEES
NT seq 1497 nt NT seq  +upstreamnt  +downstreamnt
atggggaaattggcggtgggtgcggcggtggtttgcgctgcggcggtttgtgcggcggcg
gcgctggtggttcgccaccgaatgaagagctcggggaagtggacccgagctatggcgata
ttgagggagttcgaagagaagtgtaggacccccactagtaaactcagacaggtggcagac
gccatggacgttgagatgcacgccggtcttgcatccgaaggtggaagcaagctcaagatg
atcataagctacgtcgataacctcccaactggagatgagaaaggtctttattatgctttg
gaccttggtggaacgaacttccgtgtgctgcgcgtccagttgggtggtaaagatgctcgt
gttgtcaaacaagaatttgaggaagtttcaattccaccgcatttgatgactggaacttca
gatgcattatttggttatatagccgaggcacttgcaaaatttgttgctgaagaaggtgaa
ggtttccatcctgcgcctggaagacaaagggagctgggttttaccttttcattccctgtg
aggcagacatcaattgcatcggggaatcttatcaagtggacaaaaggcttcagtattgaa
gacacagttggacaagatgtggtgggagaactcaccaaagcaatggaaagaattggcctt
gatatgcgtgtggcagctttggtcaatgatacaattggaacgttggctggaggtaaatac
cacaatcaggatgtaattgcagctgtaattttgggtactggaaccaatgctgcttatgta
gagcgggctcaggccattcccaaatggcatggtcttctacctaagtcaggagagatggtt
ataaacatggagtggggtaacttccgatcatcacaccttcctctgacagattatgatcaa
gaactggataatgagagcttgaacccaggagaacaaatctttgagaagatgatttctgga
atgtatttaggggacattgtacgcagagttttgtacaaaatggctgaagaagctgccttt
tttggtgatactgttccacccaaactgaaaattcctttcatcctaagaactcctaacatg
tctgcgatgcatcatgacacatctccggatctgagagtggttggggacaaactgagggat
attctagagatacctaacacgtccctgaaagtgagaaaagttgttgtggagctttgtgac
attgttgccactcgtggtgcccgtctatcagctgctgggatcgtaggcatcctcaagaaa
ataggaagagacacagtaagggaaggggagaagcaaaggtctgtgattgcgttggatggt
ggtttgtacgagcattacactaaattcagcacctgcatggagagtactcttaaggagttg
ctgggagaggaagtcgctgcgaacattttaatcgagcactccaatgacggatctggtatt
ggggctgctctcctggcggcttctcactcccagtacttagaggtagaagagtcttaa

DBGET integrated database retrieval system