KEGG   T30856 (Metagenome): 70239Help
Entry
70239             CDS       T30856                                 

Gene name
42_DCM_0-0d2_C6618847_1_gene70239
Definition
strand:- start:2 stop:607 length:606 start_codon:no stop_codon:no
gene_type:incomplete
  KO
K00248  butyryl-CoA dehydrogenase [EC:1.3.8.1]
Best hit
maq:Maqu_2845 (best score: 417.542)
Taxonomy
Gammaproteobacteria - Others [GN:maq]Taxonomy
Pathway
00071  Fatty acid degradation
00280  Valine, leucine and isoleucine degradation
00650  Butanoate metabolism
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01120  Microbial metabolism in diverse environments
01200  Carbon metabolism
01212  Fatty acid metabolism
LinkDB All DBs
AA seq 202 aa AA seqDB search
ERNGVSLAGLIHKLGYRGTTSTALSFGDDAPCHGYLVGEPHQGLKYMFQMMNEARVGVGF
GAAVIGYRGYMHSLEYAKDRLQGRKASEKNPESPQVPIIEHADVRRMLLAQKAYSEGGLA
LCLYGARLMDDQHTHPDEQKRQEAGKLLDLLTPVIKAWPSEYGPKANDLAIQVYGGAGYT
REYPVEQCWRDNRLNPIHEGTN
NT seq 606 nt NT seq  +upstreamnt  +downstreamnt
gaacgcaacggcgtcagcctcgctggcctgattcacaagctgggctaccgtggcaccacc
tccaccgccctgagcttcggtgatgatgctccctgtcacggctatctggttggcgagccc
caccagggcctgaagtatatgttccagatgatgaacgaagcgcgggtaggtgtgggtttc
ggcgccgccgtgatcggttatcgcggttacatgcacagcctcgaatacgccaaagatcgc
ctgcagggccgcaaggccagcgagaagaatccggaaagcccgcaggtgccgattattgag
cacgccgatgtccgtcgcatgctgctggcccagaaagcctacagtgagggtggtttggct
ttgtgcctctacggcgcccggttgatggatgaccagcacacccatcccgatgaacagaaa
cgccaggaagccggaaagctgctggacctcctcactccggtgatcaaagcatggccttcc
gaatacggccccaaggctaatgacctggccattcaggtatacggtggcgcaggttacacc
cgggagtatccggtagagcagtgctggcgtgacaaccgcctgaacccgattcacgaaggc
accaac

KEGG   T30856 (Metagenome): 116588Help
Entry
116588            CDS       T30856                                 

Gene name
42_DCM_0-0d2_C6683240_1_gene116588
Definition
strand:+ start:3 stop:722 length:720 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K00248  butyryl-CoA dehydrogenase [EC:1.3.8.1]
Best hit
maq:Maqu_2845 (best score: 485.337)
Taxonomy
Gammaproteobacteria - Others [GN:maq]Taxonomy
Pathway
00071  Fatty acid degradation
00280  Valine, leucine and isoleucine degradation
00650  Butanoate metabolism
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01120  Microbial metabolism in diverse environments
01200  Carbon metabolism
01212  Fatty acid metabolism
LinkDB All DBs
AA seq 239 aa AA seqDB search
LALCLYGARLMDDQHTHPDKQKRVEAGKLLDLLTPVIKAWPSEYGPKANDLAIQVYGGAG
YTREYPVEQCWRDNRLNPIHEGTNGIQALDLLGRKIWQDQSHGLQLLMQEMQVDLQAATT
DRCQQWALSLSETLQQAVKVTQSLGKSLMGGEVDKTLANASCYLHLFGHIIVAWMWLRQA
NAAAHALGSANSDDERNFYQGKLQAAQYFFHWELPTVAQDLVLLRNQDDTCLNMKADWF
NT seq 720 nt NT seq  +upstreamnt  +downstreamnt
ctggccctgtgcctctatggcgcccgattgatggacgaccaacacacacacccggacaaa
cagaagcgtgttgaggccggcaagttgctggacctgctcaccccggtcatcaaagcctgg
ccctccgagtacggtcccaaggccaacgatctggccatccaggtctacggcggtgctggc
tacacccgggaatacccggtcgagcagtgctggcgtgacaatcgcctgaacccgatccac
gagggcactaacggtatccaggccctggacctgctcggccgcaagatctggcaggaccag
agccacggcctgcaactgctgatgcaggaaatgcaggtggatctgcaggcggccaccacc
gaccgctgccagcaatgggcgctgtccctgagcgaaaccctgcagcaggcggtgaaagtc
acccagagcctcggcaaatccctgatgggcggcgaagtcgacaaaaccctggccaacgcc
tcctgctacctgcacctgttcggccacatcatcgttgcctggatgtggctacgccaggcc
aacgccgcagctcacgctctgggttcggctaacagcgacgacgagcgcaacttctaccag
ggcaagctgcaggcggcccaatacttcttccactgggaactgcccaccgtggcccaggat
ctggtactgctgcgcaatcaggacgacacctgtctgaacatgaaggccgattggttctga

KEGG   T30856 (Metagenome): 89012Help
Entry
89012             CDS       T30856                                 

Gene name
42_DCM_0-0d2_C6645973_1_gene89012
Definition
strand:+ start:3 stop:662 length:660 start_codon:no stop_codon:no
gene_type:incomplete
  KO
K06445  acyl-CoA dehydrogenase [EC:1.3.99.-]
Best hit
maq:Maqu_3810 (best score: 430.639)
Taxonomy
Gammaproteobacteria - Others [GN:maq]Taxonomy
Pathway
00071  Fatty acid degradation
01100  Metabolic pathways
01212  Fatty acid metabolism
LinkDB All DBs
AA seq 220 aa AA seqDB search
EDGGLGFSNTAHSEIVMKISTRSVSAAVTVMVPNSLGPGELLMHYGTDEQKQHYLPRLAG
GDEIPCFALTSPVAGSDAGAIPDKGIVCKGKWNGKEVLGLKVTWNKRYITLAPVATLIGL
AIKVYDPDKLLGDSDEIGVTCVLVPKDTDGVNAGARHLPMNTVFMNGPTWGNDVFIPMEQ
VIGGQDMLGKGWTMLLECLSIGRSISLPALGTGAGKVASL
NT seq 660 nt NT seq  +upstreamnt  +downstreamnt
gaagacggcggcctggggttctccaacaccgcccactcggaaatcgtgatgaagatttcc
acccggagcgtatcggctgccgttaccgtgatggtgcccaactccctcggcccgggcgag
ttgctgatgcactacggcaccgatgagcagaaacagcattatctgcccagactcgccggc
ggcgacgagattccctgtttcgccctcacctccccggtggccggctccgacgccggcgcc
attccggacaaaggcatcgtctgcaagggcaaatggaacggcaaggaagtgctgggcctg
aaagtcacctggaacaagcgctacatcaccctggccccggtggcgacactgatcggcctg
gccatcaaggtctatgatccggacaagctgctgggcgattccgatgaaatcggtgtgacc
tgtgtactggtgcccaaagacacggacggcgtcaacgccggtgcccgccacctgcccatg
aacaccgtattcatgaatggtcccacctggggcaacgacgtgttcattcccatggaacag
gtcatcggcggccaggatatgctcggcaagggctggaccatgctgctggagtgtctgtct
atcggccgctccatctccctgcccgccctcggcaccggtgccggcaaggtggccagcctg

KEGG   T30856 (Metagenome): 160547Help
Entry
160547            CDS       T30856                                 

Gene name
42_DCM_0-0d2_C6736385_1_gene160547
Definition
strand:+ start:2 stop:958 length:957 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K06445  acyl-CoA dehydrogenase [EC:1.3.99.-]
Best hit
maq:Maqu_3614 (best score: 561.992)
Taxonomy
Gammaproteobacteria - Others [GN:maq]Taxonomy
Pathway
00071  Fatty acid degradation
01100  Metabolic pathways
01212  Fatty acid metabolism
LinkDB All DBs
AA seq 318 aa AA seqDB search
GANIMTRSLMIFGQGAIRCHPYVLKELAAKDNDDINAFDDAFFGHAGLIFGNAARAFTQA
LGLGRADVPFDSASRKYAQAVARFSAAFGLCSDAAMTTLGSELKMRELISARLGDMLSNL
YLASMVLKNWHETQPVEGEKEVMEYSLGMLLHRTENALDEFLQNLPNRAVALVLRGVTMP
LGRRWGSPQDDLARKLARAISTDTPIRNKLIASIWHTNGEGTVENPVARYNGLLKDYDKA
EQLYRKATKAYAKGELPMTALHPEERFEAALKAGIYTKEEADFMRQYETVVLEMLTVDDF
PFDEFARNKETVIDHNPA
NT seq 957 nt NT seq  +upstreamnt  +downstreamnt
ggtgccaacatcatgacccgcagcctgatgatcttcggccagggcgccattcgctgccat
ccgtatgtgctcaaggagctggcggccaaggacaacgatgatatcaacgcgtttgacgat
gcgttcttcggccacgccgggctgattttcggcaatgccgcccgcgccttcacccaggct
cttggtcttggacgggcagatgtgccgtttgacagtgccagtcgcaagtacgcgcaggcc
gtggcccgcttcagcgcagcctttggtctgtgctcggatgccgcgatgaccacgcttggc
agcgaactgaaaatgcgggagcttatctctgcacggctgggggatatgctgtccaacctg
tacctggcttccatggtcctcaagaactggcacgagacccagccggtagagggtgagaag
gaagtaatggagtacagcctgggcatgctgctgcatcgcactgaaaacgccctggatgag
ttcctccagaacctgccgaatcgcgccgtggcgctggttctgcggggcgtcacgatgccg
cttggccgtcgctggggcagtccgcaggacgaccttgcgcgcaaactggctcgtgcaata
tccacagacacgcctatccgcaataagctgattgccagcatctggcataccaatggcgag
ggcaccgtggagaatccggtggctcgctacaacggtctgctcaaggactatgacaaggca
gaacagctataccggaaagcgaccaaggcctacgccaaaggtgaattgccgatgaccgcc
ttgcatccggaagagcggtttgaggcggccctgaaggctggtatctataccaaggaagag
gccgatttcatgcgccagtatgagaccgttgtacttgagatgctgacggtcgatgacttc
ccgtttgatgagtttgcgcgcaacaaggagacagtgattgatcacaaccctgcctga

KEGG   T30856 (Metagenome): 175062Help
Entry
175062            CDS       T30856                                 

Gene name
42_DCM_0-0d2_C6751399_1_gene175062
Definition
strand:+ start:441 stop:1334 length:894 start_codon:yes
stop_codon:no gene_type:incomplete
  KO
K06445  acyl-CoA dehydrogenase [EC:1.3.99.-]
Best hit
maq:Maqu_3614 (best score: 520.005)
Taxonomy
Gammaproteobacteria - Others [GN:maq]Taxonomy
Pathway
00071  Fatty acid degradation
01100  Metabolic pathways
01212  Fatty acid metabolism
LinkDB All DBs
AA seq 298 aa AA seqDB search
MMTFILFVVALAGLLIVMRRESGATSAIGVMAVTGLLSLIFASGLLALVLFIGAALTAAA
GLPGFRQSWLTPRIFAMFKKVAPKVSETEKVALEAGTVGWDGELFTGRPDWHNLLINRNT
GLSEEEQAFVDNQCVQAISMCNTWDVAVERADLPKELWDFLKKEGFFGMIIPKEYGGLEF
SAKAQSAVLQKLASNETLMVSVGVPNSLGPGELLVKYGTEEQKNHYLPRLADGREIPCFG
LTGPRAGSDATSLPDTGIVCKQKVDGKEVVGIRLNFEKRWITLAPIATVVGLAFRMFD
NT seq 894 nt NT seq  +upstreamnt  +downstreamnt
atgatgactttcatactgtttgtagtggcactggctggcctgctgattgtgatgcggcgc
gagtctggtgcaacgtccgcgattggcgtaatggccgttaccggcctgctgtcgctgatt
tttgcctctggtttgctggccctggttttgtttattggtgccgccctaacagctgctgcc
ggcctccccgggtttcgccaaagctggctgacaccccgcattttcgcgatgttcaagaag
gtcgcaccgaaggtttccgagactgagaaagtggctctcgaagccggtacggtcggctgg
gacggtgaactgttcactggtcggcctgactggcacaacctgctgatcaaccgcaatacc
ggcctgagcgaggaagaacaggccttcgtcgacaatcagtgtgtccaggcaatttccatg
tgtaacacctgggacgtggcggtcgagcgggctgatctgcccaaagagctgtgggacttc
ctcaagaaggaaggtttcttcgggatgatcattcccaaggaatacggtggcctcgaattc
tctgccaaggcgcagtctgcagttctgcaaaaactggcatccaacgagacgctcatggtg
tctgtgggcgtacccaattcccttggtcctggcgagctgctcgtcaagtacggcaccgag
gagcagaaaaaccattacctgccaaggcttgcagacggtcgtgaaattccttgctttggt
ctgacgggcccaagggctggttcagatgcgacgtcgcttccggacaccggtatcgtttgc
aaacagaaagtcgatggcaaggaagttgtcggtatccggctgaatttcgagaagcgctgg
atcaccctggcgcccatcgccacggttgttggccttgccttccgcatgttcgat

DBGET integrated database retrieval system