KEGG   T30911 (Metagenome): 110001Help
Entry
110001            CDS       T30911                                 

Gene name
72_DCM_0-0d2_C4247406_1_gene110001
Definition
strand:+ start:166 stop:294 length:129 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K04644  clathrin light chain A
Best hit
dct:110091946 (best score: 26.9498)
Pathway
04142  Lysosome
04144  Endocytosis
04721  Synaptic vesicle cycle
04961  Endocrine and other factor-regulated calcium reabsorption
05016  Huntington disease
05100  Bacterial invasion of epithelial cells
LinkDB All DBs
AA seq 42 aa AA seqDB search
MTASITKDINDKKKDIRTLSWYQRFWYSRQDKTIQKSKEKKK
NT seq 129 nt NT seq  +upstreamnt  +downstreamnt
atgaccgcctcaataacaaaagatataaatgacaagaaaaaagatatacgaacacttagt
tggtaccaacgtttttggtattcgagacaagataaaacaattcaaaaaagtaaagaaaag
aaaaaatga

KEGG   T30911 (Metagenome): 6182Help
Entry
6182              CDS       T30911                                 

Gene name
72_DCM_0-0d2_scaffold11412_3_gene6182
Definition
strand:- start:1256 stop:2008 length:753 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K04646  clathrin heavy chain
Best hit
mag:amb4235 (best score: 74.7146)
Pathway
04142  Lysosome
04144  Endocytosis
04721  Synaptic vesicle cycle
04961  Endocrine and other factor-regulated calcium reabsorption
05016  Huntington disease
05100  Bacterial invasion of epithelial cells
LinkDB All DBs
AA seq 250 aa AA seqDB search
MADDNAKETTAPIATEQPSEATRPEYVQEKFWNADTKQVNVENLASSYNTLEQKLGSRTE
DLSKQIRDDIEKERLNNVPESYKLNVPEIPENVNLKVDKDMDLVKWWDGTAKKAGLSQEQ
YDEGVKAFVTNAMAQLPNQDLEIQKLGDKGKDRVQAAEMWSKKHLSPEGYNNFARLAATA
EGVKVIEELMNLNKDSTMPTTPTQVDVSASADDLKSMLNDPRYYDSSRRDPAYVKRVTEL
YEKAYKNTQK
NT seq 753 nt NT seq  +upstreamnt  +downstreamnt
atggccgatgataatgctaaagaaacaacagcaccaatcgccacagaacaaccttctgag
gcaactcgacctgaatatgttcaggaaaagttttggaatgctgatacaaagcaagtcaat
gtagaaaacctagcttcaagttataatacacttgaacaaaaattaggttctcgtacagaa
gacctttctaaacaaatcagagatgatattgaaaaagaaagattaaacaatgttccagag
tcttacaaattaaatgttcctgaaattccagagaatgtaaatttgaaggttgataaagat
atggatcttgttaaatggtgggatggtactgctaaaaaagcaggactttctcaagagcaa
tatgatgaaggtgttaaagcctttgttactaatgctatggctcaattacctaaccaagat
ttagaaatacaaaaacttggtgacaaaggtaaagatagagtacaagcagcagagatgtgg
agtaaaaaacatttatcaccagaaggttataataattttgctagactagcagctactgct
gaaggagttaaggttattgaagaattaatgaatcttaataaagactctactatgccaact
acacctacacaagtagatgtttcagcttctgctgacgacttaaaatcaatgcttaatgat
cctcgttactatgatagttcaagacgagatccagcatatgtaaaaagagtaacagagctg
tatgagaaggcctacaaaaacacacaaaaataa

KEGG   T30911 (Metagenome): 21163Help
Entry
21163             CDS       T30911                                 

Gene name
72_DCM_0-0d2_scaffold40198_1_gene21163
Definition
strand:+ start:2 stop:229 length:228 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K04646  clathrin heavy chain
Best hit
osa:4338617 fro:AALO17_10800 fve:101308271 (best score: 29.261)
Pathway
04142  Lysosome
04144  Endocytosis
04721  Synaptic vesicle cycle
04961  Endocrine and other factor-regulated calcium reabsorption
05016  Huntington disease
05100  Bacterial invasion of epithelial cells
LinkDB All DBs
AA seq 75 aa AA seqDB search
PNGNLQMEQMMGKLINKLDNFDSPSQTGVKAIEVDIKKEIAIGKADMSSIKSEEVKGKVN
NKLDKLKKLRRRNGR
NT seq 228 nt NT seq  +upstreamnt  +downstreamnt
ccaaatggtaatctacaaatggaacagatgatgggtaagttgataaataaattggacaac
tttgattcaccaagtcaaacaggtgtaaaagccattgaagtggatattaaaaaagaaatt
gcaataggtaaagctgatatgagtagtattaaatcagaggaagtaaaaggtaaagttaat
aataaattagataaacttaaaaaactgagaagacgaaatggccgttaa

KEGG   T30911 (Metagenome): 25511Help
Entry
25511             CDS       T30911                                 

Gene name
72_DCM_0-0d2_scaffold47715_1_gene25511
Definition
strand:- start:8641 stop:9099 length:459 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K04646  clathrin heavy chain
Best hit
vg:11538027 (best score: 207.994)
Taxonomy
Viruses [GN:vg]
Pathway
04142  Lysosome
04144  Endocytosis
04721  Synaptic vesicle cycle
04961  Endocrine and other factor-regulated calcium reabsorption
05016  Huntington disease
05100  Bacterial invasion of epithelial cells
LinkDB All DBs
AA seq 152 aa AA seqDB search
MPDDKFSVKLKPCTPEIALSVGQNLRWEDRREVEDMTGLSAEAATVESYYGSAVGNSWYI
ENPNGKTAGVVGVTSENIIWMLCTEASTEYPYAFVKRGRHLVDSLKNPYLCNVADMRNES
HIKLLKLLGFKFLRYYVYKGVPIIEFIKLCVQ
NT seq 459 nt NT seq  +upstreamnt  +downstreamnt
atgccagacgataaatttagtgtaaaacttaagccctgcacacctgagatagctcttagt
gtagggcaaaacctacgttgggaagatcggcgtgaggtagaagatatgacagggttatct
gctgaggcagcgactgttgaatcctattatggttcagcagttggtaactcttggtatatt
gaaaatccaaatggtaagactgcaggagtagtaggtgtaacctcagagaatataatatgg
atgctttgtactgaggccagcacggagtatccttatgcatttgttaaaagaggtagacac
ttagtagattcgttaaagaatccttacttatgtaatgtagctgacatgaggaatgaatca
catatcaaacttcttaagcttttaggttttaaatttttacgttattatgtttataaaggt
gtccctattattgaatttataaaactatgtgtacagtag

KEGG   T30911 (Metagenome): 41075Help
Entry
41075             CDS       T30911                                 

Gene name
72_DCM_0-0d2_scaffold71873_1_gene41075
Definition
strand:+ start:2 stop:262 length:261 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K04646  clathrin heavy chain
Best hit
alp:LPB137_00395 (best score: 30.8018)
Pathway
04142  Lysosome
04144  Endocytosis
04721  Synaptic vesicle cycle
04961  Endocrine and other factor-regulated calcium reabsorption
05016  Huntington disease
05100  Bacterial invasion of epithelial cells
LinkDB All DBs
AA seq 86 aa AA seqDB search
ENLAIAKIQVMFEDAFGISNSDSTPATIDRAKSWFETRDCALWCEMAGTTQDHIQKLFQN
MQYNYNTKKITIDNVRFGIRRLDKKI
NT seq 261 nt NT seq  +upstreamnt  +downstreamnt
gaaaacctagctattgcaaagatacaagttatgtttgaagatgcctttggtatatctaat
tcagattcaacacctgctacaatagacagagctaagagttggtttgaaactagagattgt
gccttatggtgtgaaatggcaggaactacacaagatcatattcagaagttatttcagaat
atgcaatacaactacaacactaagaagataacaatagacaatgttagatttggaataaga
agactagataaaaaaatataa

DBGET integrated database retrieval system