KEGG   T31007 (Metagenome): 380432Help
Entry
380432            CDS       T31007                                 

Gene name
128_DCM_0d2-3_C14273661_1_gene380432
Definition
strand:- start:28 stop:627 length:600 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K01793  heparosan-N-sulfate-glucuronate 5-epimerase [EC:5.1.3.17]
Best hit
vne:CFK40_05110 (best score: 146.747)
Taxonomy
Firmicutes - Bacilli [GN:vne]Taxonomy
Pathway
00534  Glycosaminoglycan biosynthesis - heparan sulfate / heparin
01100  Metabolic pathways
LinkDB All DBs
AA seq 199 aa AA seqDB search
FAGGRCGPSIDAPWPSSLAQGYSLSVLARASFLEEEFTTGELKKLPELSERALAPFRLDS
NSGGFVTYFTDRLSLPFYEEYPTLFPSRVLNGFMFSLIGLYDCYTVFDINEAKNLFDEGM
ITLMHVLPYYDLGNRSAYDLSHLNYPSSREHFSPNPARAGYHHTHLKLLHALNSVSHFSM
EELISRWSMYLEGGSLRNN
NT seq 600 nt NT seq  +upstreamnt  +downstreamnt
ttcgcaggaggtcgttgcggcccctcaattgatgctccctggccctcatcgttagcccaa
ggatacagtctttccgttctcgcacgtgcgtcctttctcgaagaagaattcacaacggga
gaactgaaaaagcttccagaattatcagagagagctttggctccgttcaggttggattct
aattcaggaggattcgttacatacttcacagatagactctctctaccattctacgaggag
tatccgactctttttcctagtcgagtactgaacggcttcatgttctctttaatcggactc
tatgattgctacacagtttttgatatcaacgaagcgaaaaatctcttcgatgagggcatg
attacgctgatgcacgtgctgccttattatgatctaggaaacaggagtgcatatgatctg
tcacatctcaattatccatcctccagagagcacttttcgcctaatccagcaagagcaggc
tatcaccatactcatctaaaattgctgcatgcattaaattcagtgtcccacttttcaatg
gaggaattaatttcccgttggtccatgtatttggaagggggttcactaaggaataattga

DBGET integrated database retrieval system