KEGG   T31013 (Metagenome): 213037Help
Entry
213037            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold236896_1_gene213037
Definition
strand:+ start:1 stop:867 length:867 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K00435  Fe-coproporphyrin III decarboxylase [EC:1.11.1.-]
Best hit
erz:ER308_00365 (best score: 204.527)
Taxonomy
Actinobacteria [GN:erz]Taxonomy
Pathway
00860  Porphyrin and chlorophyll metabolism
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
LinkDB All DBs
AA seq 288 aa AA seqDB search
SFAKRRKIEQSPCPLKIMTLPTVKMTEGIHVMHLFYRVDRMAWDELSPRESEAARERLEA
LCAANNNASHPSLRCFANVSGKADLAFWLFHEDLAQLAQMHRDLEACFPAGSIDLVYSYF
SVTELTEYQPTEDDLKARAQREFKLEEGTPEFDAKMEELMAWKVDYEKFRLYPELPDWEV
MCFYPMLKKRQGEDNWYSLDFDTRKKLMRTHAITGRKYAGRISQLITGSTGLDDWEWGVT
LMAKEVASVKDIVHEMRKDEVTARYGDFGPFYINLRLEPPVLWEHLGL
NT seq 867 nt NT seq  +upstreamnt  +downstreamnt
tcctttgccaaacgacggaagattgaacaatctccctgcccgttaaaaattatgactttg
ccgactgtgaaaatgaccgagggcatccacgtgatgcatttgttttatcgtgtggatcgt
atggcgtgggatgaactgtccccgcgtgaaagcgaggccgcgcgcgaacgcctcgaagcc
ctctgcgcagccaacaacaatgcgtcccatccatcattacggtgcttcgccaatgtgagt
ggcaaggcggatcttgcgttttggctgttccacgaggatctcgcgcagctcgcgcaaatg
catcgcgacctcgaggcatgttttccagcaggcagtatcgatttggtttacagctatttc
agcgtcacggagttgaccgaatatcaaccgaccgaagacgacctcaaggcgcgcgcgcag
cgggagttcaagctcgaagaaggcacgccggagtttgatgccaaaatggaagagctgatg
gcgtggaaagtggattatgaaaaattcaggctctatcccgaattgcccgattgggaggtg
atgtgtttttatccaatgctcaaaaaacgacagggagaggacaattggtatagtctcgat
ttcgacacgcgcaaaaagttgatgcgcacccacgccatcaccggccgcaaatacgccggt
cgcatcagccagctcatcaccggcagcaccggcctcgacgactgggaatggggcgtcacc
ctgatggcgaaggaagtcgcctcggtaaaagacatcgtccacgaaatgcgtaaagatgaa
gtcaccgcccgctacggagatttcggccccttttacatcaacctccgactcgaaccaccg
gtcttgtgggagcatttggggttgtaa

KEGG   T31013 (Metagenome): 282063Help
Entry
282063            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22012176_1_gene282063
Definition
strand:+ start:119 stop:535 length:417 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K00435  Fe-coproporphyrin III decarboxylase [EC:1.11.1.-]
Best hit
aym:YM304_04960 (best score: 141.739)
Taxonomy
Actinobacteria [GN:aym]Taxonomy
Pathway
00860  Porphyrin and chlorophyll metabolism
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
LinkDB All DBs
AA seq 139 aa AA seqDB search
MTQPQYVTTSVGWGVLHLFCKATDRTDGQRVVAAVKEIQDSDHQVLCVAVFGHKADIGFM
ALGPDLWRLRNLQSQIQRAGLVVVDSYISMTETSEYSPDLPEEMKTPRLHPELPPEGKNA
FCFYPMSKRRESGGNWYTL
NT seq 417 nt NT seq  +upstreamnt  +downstreamnt
atgacccaaccccaatatgtcaccacttctgttggctggggtgtgctccatttgttctgc
aaagccacggatcgcactgacgggcaacgagttgtcgctgcagtgaaagaaatccaagac
agcgaccaccaggttctttgcgtcgctgtatttggacataaagcagatatcggatttatg
gccctcggccccgacctatggcgactccggaacttacaaagccagattcaacgagcgggt
ttggtggttgttgacagctacatctctatgacggagacctcggaatactctccggatttg
cctgaggaaatgaaaactcctcgattgcatccggaacttccacctgaagggaaaaacgcg
ttctgtttttacccgatgtcgaaacgtcgcgaatctggcggtaattggtacacactg

DBGET integrated database retrieval system