KEGG   T31013 (Metagenome): 100167Help
Entry
100167            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold125045_1_gene100167
Definition
strand:+ start:860 stop:1288 length:429 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
mrs:Murru_2390 (best score: 191.43)
Taxonomy
Bacteroidetes [GN:mrs]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 142 aa AA seqDB search
MKISIINGPNLNLLGKRETDIYGSTSFDDFFKNIVSNFPDVDFDYYQSNVEGELINQIQD
VGDSSDGIILNAAAFTHTSVGIADAVKSIKSKVIEVHISNTFSRESFRHKSFLSPVVDGV
IVGFGLDSYRLAVESLIEKNKD
NT seq 429 nt NT seq  +upstreamnt  +downstreamnt
atgaagattagtataattaatgggccaaatttaaatttactaggtaaaagagaaactgat
atttatggttcaacttcttttgatgatttttttaaaaatatagtttcaaattttcctgat
gttgattttgattattaccaatctaatgttgagggtgaattaattaatcaaattcaagat
gtgggtgattcttcagatggcataatacttaatgcagcagcttttacgcatacctctgtt
ggtattgcagatgctgttaaatctattaaatcaaaggtaatagaggtccatatatctaac
acattttctagggaatcatttagacacaaatcttttttatctccagttgtagatggggtt
attgttggatttggccttgatagctatagacttgcagttgaaagtttaatcgagaaaaat
aaagattaa

KEGG   T31013 (Metagenome): 102830Help
Entry
102830            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold128252_1_gene102830
Definition
strand:- start:27 stop:470 length:444 start_codon:yes stop_codon:yes
gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
pae:PA4846 (best score: 235.728)
Taxonomy
Gammaproteobacteria - Others [GN:pae]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 147 aa AA seqDB search
MASILVLHGPNLNRLGSREPGVYGATTLEQINQHLRELASQRGHHLLSLQSNAEHELIER
IHAAGDEAIDFIIINPAAFTHTSVAIRDALLAVSIPFIEVHLSNVYKREPFRHHSYFSDV
AEGVICGLGAQGYELALQAAIEKIEQH
NT seq 444 nt NT seq  +upstreamnt  +downstreamnt
atggccagcatcctggttctgcacggacctaacctgaatcgcctgggcagccgcgaaccc
ggcgtttacggcgctactaccctggagcagatcaaccagcacctgcgtgagctggccagc
cagcgcggccatcacctgctgagcctgcaaagcaatgccgagcatgagctgattgagcgc
attcatgctgccggcgatgaagccatcgacttcatcatcatcaatcctgctgcttttacc
cacaccagcgtggcaatacgtgacgcattgctcgcagtgagcatcccattcatcgaagtt
cacttatccaacgtgtataagcgcgaacctttccgtcatcactcctacttttcggacgtt
gccgaaggagtgatttgcggtctcggcgcccagggctacgagctggccctgcaggcagcc
atagagaagatcgaacaacactga

KEGG   T31013 (Metagenome): 116730Help
Entry
116730            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold145730_1_gene116730
Definition
strand:+ start:3 stop:365 length:363 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
apm:HIMB5_00003110 (best score: 144.436)
Taxonomy
Alphaproteobacteria [GN:apm]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 120 aa AA seqDB search
VTLEEVKKNCESHAKTIGIEIKFDQSNIEGEIVTMIQKAKNVYDGIIINAAGYTHTSVAI
LDALLAVKLPTIEVHITNIYNREEFRKKSLISKAANGIICGFGIKGYIMALDSIGDILKK
NT seq 363 nt NT seq  +upstreamnt  +downstreamnt
gtgacacttgaagaagttaaaaaaaattgtgaatctcatgcaaaaaccataggtattgaa
atcaaatttgatcaatcaaatattgaaggagaaattgtaacaatgatccaaaaagctaaa
aatgtttatgatggaataattataaatgcagctggctatactcatacttccgttgcaatt
cttgatgcacttttggcagttaaactaccaactatagaagtacatataacaaatatttac
aatagagaggaatttagaaaaaaatccttaataagcaaggctgcaaatggaattatttgt
ggatttggtataaaaggatatattatggctttagattcaattggagatattttaaaaaaa
taa

KEGG   T31013 (Metagenome): 117182Help
Entry
117182            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold146309_1_gene117182
Definition
strand:- start:1195 stop:1647 length:453 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
abai:IMCC26256_111019 (best score: 178.333)
Taxonomy
Actinobacteria [GN:abai]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 150 aa AA seqDB search
MSTMSDRTVLLLSGPNLNLLGEREPDIYGSATLDDHVAGATAAAAARGLALEHVQSNHEG
ELVDAIQDARGRCAGIVVNPGAFTHYAWAIHDALATFDGPIVELHLSNPAAREPWRHTSV
VAPVAAGTIAGFGAAGYRMAVEAVADLLDG
NT seq 453 nt NT seq  +upstreamnt  +downstreamnt
atgtcgaccatgagcgaccgcaccgtgctcctcctgtcgggacccaacctgaatctgctg
ggcgaacgggagccggacatctacggatcagccaccctggacgaccacgtggccggcgcc
acggcagcagccgccgcccggggactggccctggaacacgtccagtccaaccacgaaggc
gagctggtggacgccatccaggatgcccggggacggtgcgccggcatcgtggtcaaccca
ggggccttcacccactacgcgtgggccatacacgacgccttggcgaccttcgacggccca
atcgtggaactccacctctccaacccggcggcccgcgaaccatggcgccacacgtcggta
gtagccccggtggccgccgggaccatcgccggcttcggagctgccggctaccggatggca
gtggaggcggtggccgacctcctagacgggtga

KEGG   T31013 (Metagenome): 12067Help
Entry
12067             CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold16596_1_gene12067
Definition
strand:+ start:407 stop:847 length:441 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
cad:Curi_c12250 (best score: 145.976)
Taxonomy
Firmicutes - Others [GN:cad]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 146 aa AA seqDB search
MKKIILINGPNLNLLGNRENNIYGNHSLEEIKKQSEEKSAELNLECFFCQSNNEGELINF
IHSVEKEYDGLIINPAAFTHTSVALLDALRSISKPKIEIHLSNIYTREEYRKKSITSEGV
DGLICGFGSLSYILAIEAINNLIYTK
NT seq 441 nt NT seq  +upstreamnt  +downstreamnt
atgaagaaaatcatcctaattaatggcccaaatttaaaccttcttggtaatcgggaaaat
aatatttatggtaatcattccttagaagagatcaaaaaacagtcagaagaaaaaagtgcc
gagcttaatcttgagtgttttttttgtcagagtaacaatgaaggtgaactcattaatttt
attcattcagtggagaaagaatatgatggattaataattaatccagctgcttttactcac
acttcagttgctcttctagatgcacttagatctatttcaaaacccaaaattgaaattcat
ttgtccaatatatacacaagagaagaatatagaaaaaaaagcattacatcagaaggagtt
gatggattaatatgtggttttggttctcttagttatattctagctatagaagccattaat
aatttaatttatactaaataa

KEGG   T31013 (Metagenome): 120842Help
Entry
120842            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold150641_1_gene120842
Definition
strand:+ start:537 stop:959 length:423 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
ttk:TST_0147 (best score: 72.0182)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 140 aa AA seqDB search
MSAHTISKHVLIIHGPNMNLLGHRKIEANPNITLDKLNRNLRKVAKSLDMKVKIIQTNDE
TRAATTIQRQRNKTNGILFFPGPWQKSGYVLQDTLKLLSIPFVTISVGEKAEVLQGLHNI
YEADLYKAGEIALTHLSDSI
NT seq 423 nt NT seq  +upstreamnt  +downstreamnt
atgagcgcccacacaatttctaaacacgttcttattattcatggtcccaatatgaacctg
ttgggacatcgaaaaatagaagccaaccccaatattactttggataaattaaacagaaat
ttacgcaaggttgcaaaaagtcttgatatgaaggtaaaaattatacaaacaaatgatgag
accagggccgccacaaccatacagagacaacgaaataaaaccaatggaatactctttttt
cctgggccgtggcaaaaatcagggtatgttttacaggatacgcttaaattgttatcaata
ccatttgtaacaatttctgtaggagaaaaagcagaggtgttacaaggtttacacaacatt
tatgaagcagatctttataaagcaggcgaaatagcgcttacccatttatcagattcaata
taa

KEGG   T31013 (Metagenome): 122116Help
Entry
122116            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold152184_1_gene122116
Definition
strand:- start:507 stop:659 length:153 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
mts:MTES_3527 (best score: 78.1814)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 50 aa AA seqDB search
HISDVYAREEFRHYSYIRDIAAVHVVGEGVTGYARATDLLIDIIAGHADG
NT seq 153 nt NT seq  +upstreamnt  +downstreamnt
cacatctcggacgtgtacgcacgcgaggaattccgtcactattcgtacatccgcgacatc
gccgccgtccacgtggtgggcgaaggtgtgaccggctacgcacgtgcgaccgatctgctg
atcgacatcatcgccggccacgccgacggctga

KEGG   T31013 (Metagenome): 124398Help
Entry
124398            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold154901_1_gene124398
Definition
strand:- start:3 stop:380 length:378 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
tte:TTE1279 (best score: 114.775)
Taxonomy
Firmicutes - Clostridia [GN:tte]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 126 aa AA seqDB search
MTKILVVHGAGINMRGKSQVEIFGSDTMEDYSNQIKEYSKQLDVTVDIYHSNIEGEVINK
FYQAHEDGYDAAIINPAGYSSGHPALAAAITQVSYPTIEVHISNPSARGNVSQIAPSCKG
VITGFG
NT seq 378 nt NT seq  +upstreamnt  +downstreamnt
atgacgaagatattagttgttcatggtgcggggattaatatgcgaggtaagtcacaggtg
gaaattttcggtagtgacacaatggaagactatagtaaccaaattaaagaatattctaaa
cagctggatgtgactgttgatatttaccactcaaatatcgagggggaagtcattaataag
ttttaccaggctcatgaagatggctatgatgcagctattattaacccagccggttattca
tcaggtcatcctgcattggcagctgcgataactcaagtaagttatccaacaatcgaagtc
catatttccaatccctcagcaagaggtaatgtttcccagatagcaccctcctgcaaaggt
gttatcactggattcgga

KEGG   T31013 (Metagenome): 129053Help
Entry
129053            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold160364_1_gene129053
Definition
strand:+ start:513 stop:941 length:429 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
css:Cst_c05280 (best score: 161.77)
Taxonomy
Firmicutes - Clostridia [GN:css]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 142 aa AA seqDB search
MKIIIVNGPNLNLLGEREPEIYGSETLHEVNDWIKNHDVCQNLDLEFFQSNSEGAIIDFL
HSKREEVDYLVINPGALTHYSYALRDAIVGTDIKAVEVHLSDIYNRENFRKISVIKSVCL
TQIFGEGKQGYITAIKHILEKR
NT seq 429 nt NT seq  +upstreamnt  +downstreamnt
atgaagataattatagttaatggacccaatttgaatctactaggcgaaagagaaccggaa
atttatggttctgagaccctacatgaggttaatgattggattaaaaaccatgatgtttgc
caaaatcttgatttagagtttttccaatcaaattctgaaggtgcaatcattgattttctt
cattctaaaagagaagaagttgattatttggtaatcaatcctggggcattaacccattat
tcttatgcgcttagggatgcgattgttggtacagatatcaaggctgttgaagttcattta
tctgatatctataatcgagagaattttagaaaaatttcggtcattaaaagcgtttgttta
actcaaatttttggtgagggaaaacaaggatatataacagcaattaaacacatattggag
aaaagatga

KEGG   T31013 (Metagenome): 131057Help
Entry
131057            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold163061_1_gene131057
Definition
strand:+ start:111 stop:500 length:390 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
abai:IMCC26256_111019 (best score: 168.318)
Taxonomy
Actinobacteria [GN:abai]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 130 aa AA seqDB search
MTEPILLVLSGPNLNLLGEREPDVYGDATLADHVEVARQAASEHGMAVEHVQSNHEGELV
DAIQGARGRCAAILINPGAFTHYAWAIHDALASFDGPILEVHLSNPAAREPWRHTSVVAP
VAAGSIAGFG
NT seq 390 nt NT seq  +upstreamnt  +downstreamnt
atgaccgaaccgatcctgctggtcctgtcagggcccaacctgaatctgctcggcgaacgg
gagcccgacgtctacggggacgccaccctggccgaccacgtggaggtggcccgtcaggcc
gcatccgaacacggaatggccgtggagcacgtccaatccaaccacgagggcgaactggtc
gacgcaatccagggggcacggggccgttgcgcggcgatcctcatcaacccaggggccttt
acccactacgcgtgggccattcacgacgcgctggccagcttcgacggaccgatcctggag
gtccacctgtcgaatccggccgcccgggagccgtggcgccacacctcggtcgtcgccccg
gtggctgccggcagcatcgccggctttggg

KEGG   T31013 (Metagenome): 131121Help
Entry
131121            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold163146_1_gene131121
Definition
strand:- start:1 stop:264 length:264 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
cfus:CYFUS_006159 (best score: 110.538)
Taxonomy
Deltaproteobacteria [GN:cfus]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 88 aa AA seqDB search
MNILLVHGPNLNLLGKRQPEIYGTQTLDNINHYLIQVAQKQGIELKTFQSNHEGEIVSEI
GANIDWANGILINPAAYTHTSIAIRDAL
NT seq 264 nt NT seq  +upstreamnt  +downstreamnt
atgaatattttacttgttcatgggccaaatctgaatttattgggtaagcgacaaccagaa
atctacggaactcagactctcgacaatatcaatcactatttgattcaggttgctcaaaag
caaggaattgagctcaagacattccaatcgaatcatgaaggggaaatagtgtcggaaatc
ggggctaacattgattgggcaaacggaatattgattaatccagcggcttatactcacact
agtatagctattcgagacgcactt

KEGG   T31013 (Metagenome): 133970Help
Entry
133970            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold166520_1_gene133970
Definition
strand:- start:1 stop:252 length:252 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
ccz:CCALI_02387 (best score: 56.9954)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 84 aa AA seqDB search
MKILVLQGPNLNLIGVKFAQAGKSVTLDKINTALRREVRNTEIELKIFQTHKIYMAISFL
QRNRNTASGILIAPMAWAKYEYSL
NT seq 252 nt NT seq  +upstreamnt  +downstreamnt
atgaaaatactcgtacttcaagggccaaacctgaacctgattggtgtgaaattcgctcaa
gcggggaaaagcgtcactttagataaaattaatacggcactccgccgagaagtaagaaac
acggaaatagaactaaaaatattccaaacccataaaatttatatggctatttcgttcctg
cagaggaatagaaatactgcatcaggaattttaattgcacccatggcatgggcaaaatac
gaatattctcta

KEGG   T31013 (Metagenome): 134086Help
Entry
134086            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold166670_1_gene134086
Definition
strand:+ start:465 stop:599 length:135 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
cmai:BFX80_13095 (best score: 61.6178)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 45 aa AA seqDB search
MNILVINGPNLNLLGTREPEIYGTDTLEELMMWLETSPSGADHSF
NT seq 135 nt NT seq  +upstreamnt  +downstreamnt
atgaatatattggtaataaatggaccaaacctgaatttgttgggcactcgagaaccagaa
atatatggtaccgatactctagaggagctgatgatgtggttggaaaccagcccttcagga
gcagaccattccttt

KEGG   T31013 (Metagenome): 135640Help
Entry
135640            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold168502_1_gene135640
Definition
strand:- start:687 stop:1001 length:315 start_codon:no
stop_codon:yes gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
ebu:CUC76_17985 kpn:KPN_03663 (best score: 126.331)
Taxonomy
Gammaproteobacteria - Enterobacteria [GN:ebu]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 104 aa AA seqDB search
NITIDFVQSNAEHEIIDCIQSAKNNSVKFIIINPGPLTHTSIALRDTFLSTQIPFIEIHI
SNIFKREDFRKKSYLSDISSGVIAGLGTDGYQYALLQAIKLIES
NT seq 315 nt NT seq  +upstreamnt  +downstreamnt
aatataacaattgattttgttcaatcaaatgcagaacatgaaattatagattgtatacag
tctgctaaaaataattctgttaaatttataataataaaccctggtcctctaacacataca
agtattgctttacgtgatacatttctaagcactcaaatcccattcatagaaatacatatt
tctaatatttttaaacgtgaagattttagaaaaaaatcttatttaagtgatatcagttct
ggtgtaattgcaggtcttgggacagatggttatcaatatgcacttctacaagctattaaa
ttaattgagagttaa

KEGG   T31013 (Metagenome): 13922Help
Entry
13922             CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold19193_1_gene13922
Definition
strand:+ start:595 stop:1020 length:426 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
aeh:Mlg_0024 (best score: 182.57)
Taxonomy
Gammaproteobacteria - Others [GN:aeh]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 141 aa AA seqDB search
VLNGPNLNLLGEREPEVYGTTTLAEINARILNLATAQGNTLSSFQSNAEHELVDKIHEAK
KTGVDFILINPGAFTHTSIALRDAMLGTQIPFIEVHLSNVFSREEFRKSSYLSDIAVAVV
SGLGGYGYELALMGAERYLKK
NT seq 426 nt NT seq  +upstreamnt  +downstreamnt
gtgctaaatgggccaaatctaaaccttttgggcgagcgggagccggaggtctatggaaca
acgacgctagccgagataaatgccagaatactgaatttggcgacagcgcaaggtaataca
ctctcaagttttcaaagcaatgccgagcatgaactagtagataaaatacatgaggcaaaa
aaaacaggggtggattttatactaattaaccctggcgcatttacccacaccagcatagca
ctgcgtgatgcgatgctgggcacacaaattccctttatcgaagtacatttatcgaatgta
ttttcccgtgaggaatttagaaagtcttcatatttatctgacattgccgttgctgttgtg
agcggtcttggcggttatggatatgagcttgccttaatgggcgctgaacgatacttaaaa
aaataa

KEGG   T31013 (Metagenome): 140573Help
Entry
140573            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold174451_1_gene140573
Definition
strand:+ start:71 stop:508 length:438 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
tsn:W908_07685 (best score: 170.244)
Taxonomy
Gammaproteobacteria - Others [GN:tsn]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 146 aa AA seqDB search
MSNNKLLIINGPGLSDLSNCNETGYDDLTLDAVQQKCSETCEGLGLEMDFRQNDDEAELL
NVLIEDSDNFDAFIINPAGHSQASSVDLDMYSTTINKISNQSKPVVEVRIENIFKQGNKN
NKPFQVPESGLGFVGGLGMYSYVLAI
NT seq 438 nt NT seq  +upstreamnt  +downstreamnt
atgagcaataataaattattaataattaatggccctgggctatcagatttaagcaattgt
aatgagacaggctatgatgatctaacattagatgctgtgcaacaaaaatgctcagagact
tgtgagggtttgggccttgaaatggattttcgccaaaatgatgatgaagctgagttgttg
aatgttttaattgaagatagtgataattttgatgctttcataattaacccagctggacat
tcacaagcatcatctgtagatcttgatatgtatagcacaacaatcaataaaattagtaat
caaagcaagccagttgttgaagttcgtattgaaaatatttttaagcaaggtaataaaaac
aataagccatttcaggtgccagagagtggactgggctttgtcggtgggcttggcatgtat
agttatgtgctcgctatt

KEGG   T31013 (Metagenome): 146824Help
Entry
146824            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold181531_1_gene146824
Definition
strand:+ start:1 stop:162 length:162 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
pmu:PM1093 (best score: 93.2041)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 53 aa AA seqDB search
IPFIEVHLSNVYKREPFRHHSYFSDVAEGVICGLGAKGYELALQAAIHKIDQN
NT seq 162 nt NT seq  +upstreamnt  +downstreamnt
atcccattcatcgaagttcacttatccaacgtgtataagcgcgaacccttccgtcatcac
tcctacttttcggacgtagccgagggagtgatctgcggtctgggagccaagggctacgag
ctggccctgcaagccgcgatacacaagatcgaccaaaactga

KEGG   T31013 (Metagenome): 15063Help
Entry
15063             CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold21064_1_gene15063
Definition
strand:+ start:1079 stop:1615 length:537 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
afa:UZ73_00570 (best score: 119.398)
Taxonomy
Betaproteobacteria [GN:afa]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 178 aa AA seqDB search
MPLSHDRQFHAVKLSEFRKGGEIWRVVVLNGPNLSADINAMGDFEVLLSEWAADLGVQIE
HFQSNHEGRVLEFIHRSSSTANGYLVNPGGLTHVGESLRHALKDTALPVVEVHCDNVELD
HRSIFAPSVTSIFSGLRQSSYLGALVSLVLALDDPDFLHPGGTSAINRSHGTPKSLFQ
NT seq 537 nt NT seq  +upstreamnt  +downstreamnt
atgccacttagtcacgatcggcaatttcacgctgtgaaacttagcgagtttcgaaaaggc
ggcgaaatttggcgggttgtcgtcctcaacggcccgaacttgtctgcggacatcaacgca
atgggtgatttcgaggtactgctaagtgaatgggcagcggatctcggcgttcagattgag
cacttccaatcaaaccatgaaggccgggtgttggagttcattcatcgcagttcctcaacc
gctaacggttatctcgtaaatccaggtggtttgacccacgtaggggagtcgcttcgacac
gcgctgaaagacaccgcgctccctgtagtggaggtgcactgcgataatgtcgagttggat
caccgctccatcttcgccccgagcgtgaccagcattttctccgggctgcgccaatccagc
tatctcggcgcgcttgtctccctagtcctcgcactcgacgacccggattttctacaccca
ggcgggaccagcgccataaaccgatcccacggcacgcccaaatctctctttcagtaa

KEGG   T31013 (Metagenome): 15064Help
Entry
15064             CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold21064_1_gene15064
Definition
strand:+ start:1632 stop:2114 length:483 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
msm:MSMEG_2532 (best score: 133.65)
Taxonomy
Actinobacteria [GN:msm]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 160 aa AA seqDB search
MRVNESDTTNRWKIALLNGLNMTNLGQRDKHVYGTIGSLQELEDLVASVATKLGAGIISF
HSNHEGDLIDFIENDPTIDAYMINPGGLWAYGEPTRIALVQTGKPFVEVHFANIFATGHA
SVFTESAAGTVMGFRHHGYLGALIGLVAELDSGRLAGISD
NT seq 483 nt NT seq  +upstreamnt  +downstreamnt
atgcgtgtgaatgaatctgacactaccaaccggtggaagattgccttgctcaacggtctc
aacatgaccaatctcgggcagagggacaagcacgtctatggcacgattggctcactccag
gagttggaggaccttgttgcgtctgtcgcaacgaaacttggtgccggcataatttcattt
cactccaaccatgaaggggatcttatcgatttcattgaaaatgaccccaccatcgatgcg
tacatgataaatcccggtggactctgggcgtatggagaacccaccaggatcgcgttagtg
cagacaggaaaacccttcgttgaagtccactttgcaaacatctttgcgacaggtcacgcc
tccgtatttaccgaatcagcggcaggtaccgtcatgggctttcgccaccacggttatcta
ggggcacttatcgggctcgtggctgagcttgattcgggccgtttggcgggaatttcagat
tag

KEGG   T31013 (Metagenome): 160076Help
Entry
160076            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold196194_1_gene160076
Definition
strand:- start:159 stop:623 length:465 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
pub:SAR11_0728 (best score: 214.927)
Taxonomy
Alphaproteobacteria [GN:pub]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 154 aa AA seqDB search
MHYKLIVSNIIIINGPNLNLLGEREQSQYGKITFNDLKNICLERSKKIGIKLDFFQSNLE
GEIVTKIQNSRKEYDGIIINAAGYTHTSVSIRDALDIFKKPIIELHISNIYKREEFRQKS
LISNIVTGIICGLGSNGYILAINAMQELLKNGNR
NT seq 465 nt NT seq  +upstreamnt  +downstreamnt
atgcattataagcttattgtgagtaatataataattattaatggtccaaatcttaatcta
ttaggtgagagagaacaatctcaatatggaaaaattacatttaatgatttaaaaaatata
tgtttagaacgctcaaaaaaaataggaataaaattagattttttccagtcaaatttagaa
ggtgaaatagtaactaaaatacaaaattctagaaaagaatacgatggcataattatcaat
gcggctggatatacccatacatctgtgtctatccgggacgcgctagatatatttaaaaaa
ccaattatagaattgcacatttcaaatatatacaaaagagaagaatttagacaaaaatca
cttataagtaatattgtaactggaattatttgtggtcttgggtcaaatggttatattttg
gccataaatgcaatgcaagaattactaaaaaatggaaatagataa

KEGG   T31013 (Metagenome): 162172Help
Entry
162172            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold198408_1_gene162172
Definition
strand:- start:3 stop:152 length:150 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
gth:Geoth_1267 (best score: 66.2402)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 50 aa AA seqDB search
MKNILLINGPNLNLLGKREPSIYGDKSLDQIEQELVSNAQQANCSLECFQ
NT seq 150 nt NT seq  +upstreamnt  +downstreamnt
atgaaaaatatattgctaattaatggtcctaatttaaatcttttaggtaaaagagagcca
agtatctatggcgataaaagtttagatcaaattgaacaagaacttgtatccaatgctcaa
caagctaattgttctttagagtgctttcaa

KEGG   T31013 (Metagenome): 163921Help
Entry
163921            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold200102_1_gene163921
Definition
strand:- start:3 stop:242 length:240 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
hsw:Hsw_1856 (best score: 126.716)
Taxonomy
Bacteroidetes [GN:hsw]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 80 aa AA seqDB search
MKVIIINGPNLNLLGKREKSIYGDISFEEYFSQLVEGFPDLELEYFQSNVEGELIDKLQE
VGFSYDHILLNAGGYTHTSV
NT seq 240 nt NT seq  +upstreamnt  +downstreamnt
atgaaagtgataataattaacggaccaaatttaaacttattaggcaaaagagagaaatct
atttatggagatatttcttttgaggagtatttttctcagttggtagaggggtttcctgat
ttggaattagaatattttcaatcgaatgtagaaggggagttgattgacaagctgcaagaa
gttggtttttcgtatgaccatattttacttaatgcaggaggttatacgcatacctctgta

KEGG   T31013 (Metagenome): 167684Help
Entry
167684            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold203909_1_gene167684
Definition
strand:+ start:726 stop:1151 length:426 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
sun:SUN_1038 (best score: 106.301)
Taxonomy
Epsilonproteobacteria [GN:sun]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 141 aa AA seqDB search
MGKVLVIQGAGMNMRGKAQLETFGPMTLGEMNEQIVGYAEELGMDVEMFHSNIEGEVINA
LYAAHDDDYEAGIINPAGYTTTTGPIKAAIAQVKFPMIEVHASNPTARGTVSQIQPVCKG
SVYGFGIYGYKLALEAIKQMA
NT seq 426 nt NT seq  +upstreamnt  +downstreamnt
atgggcaaagttttggtgattcaaggcgcgggcatgaatatgaggggcaaggcccaattg
gagacgttcggacccatgaccttgggagagatgaacgaacagatcgtcggctacgccgag
gagttagggatggacgtcgaaatgttccattccaatatcgaaggcgaagttataaacgct
ttgtacgcagcccatgacgatgactatgaagccgggataatcaatccagccggttacacg
acgactaccggacccatcaaggccgcgatcgcccaggtaaaattcccgatgatagaagtg
catgcttccaaccccacggcccgcggcaccgtctcacagatacaacctgtctgcaaaggc
tccgtgtatggctttgggatctacggctacaaactggccctggaagcgatcaagcagatg
gcctag

KEGG   T31013 (Metagenome): 172766Help
Entry
172766            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold208470_1_gene172766
Definition
strand:+ start:2974 stop:3336 length:363 start_codon:yes
stop_codon:no gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
cth:Cthe_0849 (best score: 150.984)
Taxonomy
Firmicutes - Clostridia [GN:cth]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 121 aa AA seqDB search
MKKILVINGPNLNMLGKREKNIYGDKTLEKINASLNVLAKSKNIDLEFFQSNHEGEIIDK
IHNLNNKIDGCIINAGALTHSSTALHDAIKSVEFPFIEVHMSNIYARKESWRHTSLISPV
V
NT seq 363 nt NT seq  +upstreamnt  +downstreamnt
atgaaaaaaatattggttattaacggacctaacttaaatatgcttgggaaaagggaaaaa
aatatctatggtgataaaacccttgaaaaaatcaatgcttctttaaatgtattagcaaaa
tcaaaaaatattgatttagaattctttcaaagtaatcatgaaggtgaaataattgataaa
atccataatttaaataacaaaattgatggttgtattataaatgctggcgccttgacccat
tcttcaacagccctacacgatgctattaaatcagtagaatttccgttcatagaagttcac
atgtctaatatttatgccagaaaagaatcttggagacatacttctctaatttctccagta
gtt

KEGG   T31013 (Metagenome): 179948Help
Entry
179948            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold214700_1_gene179948
Definition
strand:- start:445 stop:516 length:72 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
abg:Asbog_02097 (best score: 35.4242)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 23 aa AA seqDB search
GIICGFGVNGYIMALNSMKDILK
NT seq 72 nt NT seq  +upstreamnt  +downstreamnt
ggaattatttgtggattcggtgtaaatggatatattatggctttaaactcaatgaaagat
attcttaaataa

KEGG   T31013 (Metagenome): 184564Help
Entry
184564            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold218209_1_gene184564
Definition
strand:- start:141691 stop:142131 length:441 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
lyd:D7I47_13160 (best score: 230.72)
Taxonomy
Actinobacteria [GN:lyd]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 146 aa AA seqDB search
MTRVFVLNGPNLGRLGSREPEVYGHQDLSALRVMLASDPSAEGIEIDLRQTDDEGELIGW
LHEAVDANAPVILNPAAFTHYSYALRDAAALVAKAGLPLVEVHISNPHARETFRHTSVIS
GIASGVIAGFGFDSYVLALAAVRRAN
NT seq 441 nt NT seq  +upstreamnt  +downstreamnt
atgacgcgcgtcttcgttctcaacggacccaacctcggtcgcctcggcagccgggagccg
gaggtctacgggcaccaggatctctcggcgctgcgcgtgatgctcgcgagcgacccgagc
gccgagggcatcgagatcgacctgcggcagaccgacgacgagggcgagctgatcggctgg
ctgcacgaggcggtcgacgcgaacgcgccggtgatcctgaatccggcggccttcactcac
tacagctacgcgctgcgcgacgcggccgcgctcgtcgcgaaggcgggccttccgcttgtc
gaggtgcacatctcgaacccgcacgcacgggagaccttccggcacacgagcgtgatctcg
ggcatcgcctcgggcgtcatcgccggcttcgggttcgactcgtacgtcctcgccctcgcg
gcggttcgtcgcgcgaactga

KEGG   T31013 (Metagenome): 190111Help
Entry
190111            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold222083_1_gene190111
Definition
strand:+ start:971 stop:1381 length:411 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
cpi:Cpin_2345 (best score: 188.734)
Taxonomy
Bacteroidetes [GN:cpi]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 136 aa AA seqDB search
MRVIIINGPNLNLLGKREKSIYGDISFEAYFERLKEEFSTIELEYYQSNVEGELINKLQE
VDFSYDAILLNVGGYTHTSVALADTVAAIETPVIEVHISNIYAREEFRKKSLLSPNCKAV
ICGLGLDSYKAGLLTL
NT seq 411 nt NT seq  +upstreamnt  +downstreamnt
atgcgagtgattattattaacggaccaaatttaaacttattaggcaaaagagagaaatct
atttatggggatatttcttttgaggcgtattttgaaagattaaaagaggaattttctact
attgaattagagtattaccaaagcaatgtagagggtgaactgataaataaactgcaagaa
gttgacttttcttatgatgctattttgctaaatgtaggaggatatacgcatacttctgtt
gcacttgctgatacagttgctgccattgaaacgccagtaattgaagtgcatatttccaat
atatatgctcgtgaggaattcaggaaaaaatcattgttgtctcctaattgcaaggcggtt
atttgtggtctgggattggattcttataaagcgggtttattaactttataa

KEGG   T31013 (Metagenome): 190675Help
Entry
190675            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold222470_1_gene190675
Definition
strand:- start:253 stop:537 length:285 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
pub:SAR11_0728 (best score: 147.132)
Taxonomy
Alphaproteobacteria [GN:pub]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 94 aa AA seqDB search
GEIVTIIQEAKKKYDGLIINAAGFTHTSVAIRDALAIFKKPSIELHISNIYKREEFRHKS
MISDVVTGIICGLGTNGYILAINAMHELLKDGNR
NT seq 285 nt NT seq  +upstreamnt  +downstreamnt
ggtgaaattgtaactattatacaggaagctaaaaaaaaatatgatggattaataattaat
gcggcaggattcacgcatacttctgtcgctattcgtgatgcactggctatttttaaaaaa
cctagtatcgaacttcatatatcaaacatatataaaagagaggaatttagacataaatct
atgattagtgacgtagtaactggaataatttgtgggttaggtactaatggttatattttg
gccataaatgcaatgcatgaattgctaaaagatggaaatagataa

KEGG   T31013 (Metagenome): 193372Help
Entry
193372            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold224382_1_gene193372
Definition
strand:- start:1171 stop:1491 length:321 start_codon:no
stop_codon:yes gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
ele:Elen_2547 (best score: 129.798)
Taxonomy
Actinobacteria [GN:ele]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 106 aa AA seqDB search
EQPETDGHSITWFQSNHEGEIIDQLHSAIKEVDGILINPGAFTHYSYAIRDAVTAIGVPT
VEVHLSNIYQREEFRKISVLKDVCIGQFSGKGKNGYLEALRLLIRK
NT seq 321 nt NT seq  +upstreamnt  +downstreamnt
gaacagccggaaactgatggacattccatcacttggttccagtccaaccatgaaggggaa
attattgatcaactgcattcagccataaaagaagtggatggtattcttataaatcccggt
gcattcactcattattcgtatgccattcgtgatgctgtgactgcaatcggtgttcctact
gtagaagtacatttaagtaatatctatcaacgggaggagtttaggaagatctctgttctt
aaggacgtatgtatagggcagttttccgggaaaggtaaaaacggctacctggaagctttg
agactgttaataagaaagtaa

KEGG   T31013 (Metagenome): 193618Help
Entry
193618            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold224549_1_gene193618
Definition
strand:- start:24 stop:476 length:453 start_codon:yes stop_codon:yes
gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
abai:IMCC26256_111019 (best score: 181.415)
Taxonomy
Actinobacteria [GN:abai]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 150 aa AA seqDB search
MLAMSDRTVLLLSGPNLNLLGEREPEVYGSATLDDHVAGAAAAAAARGIDLEHIQSNHEG
ELVDAIHAARGRCAGIVVNPGAFTHYAWAIHDALAAFDGPVVELHLSNPAAREPWRHTSV
VAPVAAGTIAGFGAAGYRMAVDAVADLLDG
NT seq 453 nt NT seq  +upstreamnt  +downstreamnt
atgttggccatgagcgaccgcaccgtgctcctcctttcgggacccaacctgaacctgctg
ggcgagcgagagccagaggtttacgggtcggccaccctggacgaccatgtggccggtgcc
gctgcggccgccgcagcgcggggaatcgatctggagcacatccagtccaaccacgagggt
gagctggtggacgccatccacgccgcccgggggcggtgcgccggcatcgtggtcaacccc
ggagccttcacccactacgcgtgggcgatccacgacgccttggccgccttcgacggtcca
gtcgtggaactgcacctctccaacccggcggcccgcgagccgtggcgccacacgtcggta
gtcgccccggtagccgccgggaccatcgccggcttcggagccgccggctaccggatggct
gtcgacgctgtggccgacctcctggacgggtga

KEGG   T31013 (Metagenome): 202949Help
Entry
202949            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold230633_1_gene202949
Definition
strand:+ start:106 stop:552 length:447 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
txi:TH3_11985 (best score: 175.252)
Taxonomy
Alphaproteobacteria [GN:txi]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 148 aa AA seqDB search
MNKKILIINGPNLNLLGDREPEVYGNETLDDIKNLCEKKGKDLSLDIDFTQSNDEGEIVE
SIQNAKKKFSGIIINAGALTHTSISILDALLSTKLPIIEVHLSNIFTREAFRKESFVSKA
AKGIICGFGSKSYDLALEAISTLLKGKN
NT seq 447 nt NT seq  +upstreamnt  +downstreamnt
atgaacaaaaaaattttaataataaacgggccaaatttaaaccttttaggagatagggag
ccggaggtgtacggaaacgaaactctggatgatataaaaaacctatgcgaaaaaaaggga
aaagacctttctttagacatagattttactcaatcaaacgatgaaggagaaatagttgaa
tcgatacaaaatgcaaaaaagaaattttccggcatcattattaacgcaggagcactcact
catacttcgatatctattctagatgcactgttgtcaacgaaattaccaattattgaagtt
cacctatcaaatatttttactcgtgaggcctttagaaaagaatcctttgtcagcaaagca
gcaaaagggattatttgcggattcggaagtaagagttacgatctggctttagaggctatc
tcaaccctcttaaaaggaaaaaattaa

KEGG   T31013 (Metagenome): 2049Help
Entry
2049              CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold2862_1_gene2049
Definition
strand:+ start:6446 stop:6898 length:453 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
abai:IMCC26256_111019 (best score: 177.178)
Taxonomy
Actinobacteria [GN:abai]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 150 aa AA seqDB search
MSTMSDPTLLLLSGPNLNLLGERQPDVYGTESLDDHVESARVAAGARGLTLEHFQSNHEG
ELVDAIHAARGRCAGIVVNPGAFTHYAWAIHDALAAFEGPVVELHLSNPAAREPWRHTSV
VAPVASGTIAGFGGAGYRMAVEAVADLLAG
NT seq 453 nt NT seq  +upstreamnt  +downstreamnt
atgtcgaccatgagcgacccaaccctcctgctcctgtcgggcccgaacctgaacctgctc
ggggaacgccagcccgacgtctacggaacggaatccctggacgaccacgtggagtccgcc
cgggtggctgccggtgcccggggcctgacgctggagcacttccagtccaaccacgagggc
gagctggtggacgccatccacgcggcgcgtggtcgatgtgcgggcatcgtggtgaatccc
ggggcgttcacacactatgcgtgggccatccacgacgccctggctgccttcgagggcccg
gtggtggagctccacctctccaacccggcggcccgcgagccgtggcgccacacgtcggtg
gtcgcaccggtggcttccgggaccattgccggtttcggtggggccggctaccggatggcg
gtcgaggccgtcgccgacctcctggccgggtga

KEGG   T31013 (Metagenome): 205113Help
Entry
205113            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold232025_1_gene205113
Definition
strand:+ start:499 stop:888 length:390 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
pns:A9D12_10330 (best score: 198.364)
Taxonomy
Alphaproteobacteria [GN:pns]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 130 aa AA seqDB search
MTDIVFVLNGPNLNLLGTREPEIYGSTTLADIAAMLEQKAGEIGLVVDFRQTNHEGVLVD
WLHEAHTAGAKAVLLNAAAYTHTSIALLDAIKAIDVPVIEVHLSDPATREGFRHLSYVGM
AAVDEVKGLG
NT seq 390 nt NT seq  +upstreamnt  +downstreamnt
atgaccgatattgtcttcgtcctcaacggccccaacctcaacctgctcggcacgcgtgag
ccagagatttacggttcgaccaccctggccgatatcgccgcaatgctggaacagaaggcg
ggcgagatcggcctcgtcgtcgacttccgtcagaccaatcatgaaggcgtactggtcgac
tggctgcacgaggcgcacaccgcgggcgccaaggcggtgttgctgaacgccgctgcctat
acccacacgtcgatagccctgctcgatgcgatcaaggccatcgacgtgccggtaatcgaa
gttcacctgtccgacccggcgacacgcgaagggtttcggcacctttcctatgtcggcatg
gcggcggtggacgaagtgaaaggcctgggc

KEGG   T31013 (Metagenome): 206507Help
Entry
206507            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold232946_1_gene206507
Definition
strand:+ start:1 stop:63 length:63 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
bma:BMA2500 (best score: 33.8834)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 20 aa AA seqDB search
VICGLGWQGYVYALRQLASK
NT seq 63 nt NT seq  +upstreamnt  +downstreamnt
gtcatttgcgggctgggctggcaagggtatgtgtacgccttgcggcaactggcctcgaag
taa

KEGG   T31013 (Metagenome): 209824Help
Entry
209824            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold234959_1_gene209824
Definition
strand:+ start:3 stop:395 length:393 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
mht:D648_2650 (best score: 153.295)
Taxonomy
Gammaproteobacteria - Others [GN:mht]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 130 aa AA seqDB search
REPDIYGSITMEQIDKGLEKKASKNNIYLESFQSNAEHEIVSKLQESMDETDYIIINPGA
LTHTSIAIRDALLGIDIPFYEIHISNIFSREEFRHKSFFSDIAAGVICGLGSQGYDMALN
HIIETYKDKK
NT seq 393 nt NT seq  +upstreamnt  +downstreamnt
agagaacctgatatctatggctctataaccatggaacaaattgataagggtttagaaaaa
aaggcttctaaaaataatatatatcttgagtcatttcaaagcaatgcggaacatgaaatt
gtttctaaacttcaagaatcaatggatgaaaccgattatattattattaatcctggggct
ttaactcacacaagcatcgctatcagggatgccctattgggaattgatatccctttttat
gaaatacatatttcaaatatcttctcaagagaagagtttaggcataaatcttttttctct
gacatagctgcgggcgtaatctgcggcttaggaagccaaggttatgacatggcgttaaat
catattattgaaacatataaggataaaaaataa

KEGG   T31013 (Metagenome): 212314Help
Entry
212314            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold236469_1_gene212314
Definition
strand:- start:3 stop:296 length:294 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
sml:Smlt4239 (best score: 135.576)
Taxonomy
Gammaproteobacteria - Others [GN:sml]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 98 aa AA seqDB search
LAKFLILHGPNLNLLGQREPEHYGQVTLAEIDQRLSDLAATRGHHTEHLQSNSESVLVER
IQEAPQQDVSFILINPAAFTHTSVAIRDALAAVAIPFI
NT seq 294 nt NT seq  +upstreamnt  +downstreamnt
ttggctaaatttctcattttgcacggccccaacctgaacctgctaggccaacgagagccg
gaacattatggccaggtgacattggccgaaatagatcagcgactttcggatctcgcagcg
actcgtggacatcacaccgagcacctgcagtccaactctgagagtgtgcttgtagagcgc
atccaagaagcgcctcaacaggatgtctcatttattctcatcaatccggccgcgtttacc
cacaccagcgttgccatccgcgacgccctggctgctgtcgcgattccgtttatc

KEGG   T31013 (Metagenome): 217405Help
Entry
217405            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold239474_1_gene217405
Definition
strand:- start:526 stop:966 length:441 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
hor:Hore_06130 (best score: 150.214)
Taxonomy
Firmicutes - Clostridia [GN:hor]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 146 aa AA seqDB search
VKILVVNGPNLNNLGKRDESHYGSESFSDVIRAIEKFSKELGVETNFFQSNSEGELVSFI
QKEASTSDGIVINAGALTHYGLSLKDSLIDAKIPLVEVHISNIHQREKYRRTSVVESVAI
GQVAGFGTSGYLYAIELLIHYLENAI
NT seq 441 nt NT seq  +upstreamnt  +downstreamnt
gtgaagatactggttgtcaatggacctaatctcaacaatttaggtaaaagggatgaatct
cattacgggtctgaatcatttagtgacgtcattagagctattgaaaaattttcaaaggag
ctcggcgtcgaaacaaattttttccaaagtaactcagaaggcgaattggttagtttcatc
caaaaggaagcgtctacttcagatgggattgtgattaatgccggagctttgacccattat
gggttatctctcaaggattcattgatagatgcaaaaattcccctagtggaagtacatata
tccaacatacatcagcgggaaaagtataggagaacttctgtggtggagtctgtggctatc
ggacaagtggctgggtttgggacttctggatatttgtatgctatcgaactgttgatccat
tatctcgaaaatgcaatctaa

KEGG   T31013 (Metagenome): 218668Help
Entry
218668            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold240201_1_gene218668
Definition
strand:- start:3 stop:170 length:168 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
vgo:GJW-30_1_03430 thw:BMG03_09815 rpa:RPA2437 (best score: 69.3218)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 56 aa AA seqDB search
MGRSDERKKGLTMAKTIYILNGPNLNLLGKREPEIYGAETLADVEKSCGERASKEG
NT seq 168 nt NT seq  +upstreamnt  +downstreamnt
atgggacggagcgatgagcggaagaagggcctgacgatggcgaagacgatctacattctc
aacggaccgaacctgaaccttttgggaaaacgggaaccggagatctatggcgcggaaacg
ctggccgacgtggaaaagtcctgcggcgagcgtgcttccaaggaaggc

KEGG   T31013 (Metagenome): 224597Help
Entry
224597            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold243548_1_gene224597
Definition
strand:+ start:3 stop:419 length:417 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
pub:SAR11_0728 (best score: 212.616)
Taxonomy
Alphaproteobacteria [GN:pub]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 138 aa AA seqDB search
NLNLLGEREQSQYGSITFDSLKDICLKKSEDLGIKLDFLQSNIEGEIVSIIQDARNKHDG
IIINAAGFTHTSVSIRDALTIYKKPIIELHISNIYKREEFRHKSLISGVVTGIICGLGSN
GYILAINAMHELLKNGNR
NT seq 417 nt NT seq  +upstreamnt  +downstreamnt
aatcttaatctattaggtgaaagagaacaatcccaatatggttctataacatttgatagt
ttaaaagatatctgtttaaaaaaatcagaagatttgggaataaagttagattttcttcaa
tccaatatagaaggagaaattgtcagcataattcaggatgcgagaaataaacatgatgga
ataattattaacgctgcaggatttactcatacatctgtttcaataagagatgccttaact
atatataaaaaacccataattgaattacatatatcaaatatatataaacgagaagaattt
agacacaaatcactcattagcggagttgtaacaggaattatttgtggattaggatctaat
ggttatattttggccataaatgcaatgcatgaattgctaaaaaatggaaatagataa

KEGG   T31013 (Metagenome): 225788Help
Entry
225788            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold244220_1_gene225788
Definition
strand:- start:1 stop:279 length:279 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
tta:Theth_0488 (best score: 66.2402)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 93 aa AA seqDB search
MKILVLQGPNLNLIGVKSAQAGKRVTLDKINKMLQREVRNTEIELKIFQTHKIYMAISFL
QRNRNTASGILIAPMAWAKYEYSLLETLQLIQL
NT seq 279 nt NT seq  +upstreamnt  +downstreamnt
atgaaaatactcgtacttcaagggcctaacctgaatctgattggtgtaaaatctgctcaa
gcggggaaaagggtcactctggataaaattaataaaatgctccaacgtgaagtaagaaac
acggagatagaacttaaaatattccaaacccataaaatttatatggctatttcgttcctg
caaaggaatagaaatactgcatctggaattttaattgcccccatggcatgggcaaaatat
gaatattcccttctggagacacttcagctcattcaattg

KEGG   T31013 (Metagenome): 227564Help
Entry
227564            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold245176_1_gene227564
Definition
strand:- start:334 stop:819 length:486 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
anx:ACH33_06310 (best score: 157.918)
Taxonomy
Firmicutes - Bacilli [GN:anx]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 161 aa AA seqDB search
ASTKPDCRGAQWERNLPATILVINGPNLNNLGKRDSSLYGTKTLGDIEADIAAKASELGV
GVEFFQSNHEGSIVDFIQESSAGASGIIINAGALTQVGYSILDALLDAGLPFIEVHLSNI
HGRERFRRRSVFASKAVGQMAGFGPAGYIYALDHLVSVVNG
NT seq 486 nt NT seq  +upstreamnt  +downstreamnt
gccagcacgaaacccgattgccgcggggcgcaatgggagcgcaacttgccagccacgatt
cttgtaataaatggaccgaacctgaataacctcggcaagcgagacagttcgctttacggc
acgaagacgctgggcgacattgaggcggatattgcggccaaagcatctgaacttggcgtc
ggggtggagtttttccagtcgaaccacgagggctcgatcgtcgacttcatccaggaatcg
tcggcgggtgcaagcgggatcatcatcaacgccggtgcgctaacccaggtcgggtactcg
atactcgatgcgctgctggatgcaggtctgcctttcattgaggtccacctgtcgaatatc
catggccgcgagaggtttcggcggcggtcggtgtttgcttcgaaggcggtcggccagatg
gcgggattcgggccagccgggtacatttacgctctcgaccacctcgtgtcggtcgtcaac
ggttaa

KEGG   T31013 (Metagenome): 23040Help
Entry
23040             CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold32878_1_gene23040
Definition
strand:- start:191 stop:658 length:468 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
ccz:CCALI_02387 (best score: 154.836)
Taxonomy
Armatimonadetes [GN:ccz]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 155 aa AA seqDB search
MHANHWEHVLPTTIIIINGPNLNNLGKRDTSLYGTKTLANIENDISIKASNIGVEVKFFQ
SNHEGSIVEFIQEWSDQADGVIINAGALTQVGYSILDALLDTKLPLIEVHLSNIHAREEF
RQKSVFAGSAIGQIAGFGPAGYLYALEHISSLIDR
NT seq 468 nt NT seq  +upstreamnt  +downstreamnt
atgcacgcgaatcattgggagcatgtgttgccaacaacaataatcataataaacggacca
aatctaaataatcttggcaaaagagacacgtccctttacggtacaaaaacgctagctaat
attgaaaacgatatttctataaaggcttcgaatattggagtagaagtaaaattcttccaa
tccaaccatgaaggttcgatagtcgaattcattcaagaatggtcagaccaagccgatggt
gtaatcattaacgcgggcgcattgacgcaagttgggtactccattcttgatgcgttactt
gacaccaagcttccattaatcgaagttcacctttcgaatattcacgcccgtgaggaattc
cgtcagaaatcagtatttgccggcagtgctatcggacaaatagcaggttttggtcccgca
ggttacctttacgccctagaacacatatcctcgctaatagaccgttaa

KEGG   T31013 (Metagenome): 232296Help
Entry
232296            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold247520_1_gene232296
Definition
strand:- start:3 stop:128 length:126 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
epo:Epro_1155 (best score: 57.3806)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 42 aa AA seqDB search
MKKILVINGPNLNLLGSRDPAIYGNKNLQDVERMLNKFLEKN
NT seq 126 nt NT seq  +upstreamnt  +downstreamnt
atgaaaaaaattctagttattaatggtccaaatttgaatcttcttggatcaagagatcct
gcaatttatggcaataagaatcttcaagatgttgagaggatgttaaataaatttctagaa
aaaaat

KEGG   T31013 (Metagenome): 236411Help
Entry
236411            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold249462_1_gene236411
Definition
strand:- start:3 stop:392 length:390 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
rbm:TEF_12395 (best score: 164.081)
Taxonomy
Alphaproteobacteria [GN:rbm]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 130 aa AA seqDB search
MNQKILVINGPNLNLLGTREKEKYGKSSLEDIKNKCESYSKKIGLEVEFRQSNVEGEIVN
FIQDSSKNYEGIIINAGGYTHTSVAILDALLAVKKPTIELHITNIYKREDFRHKSLISKA
ADGIICGLGV
NT seq 390 nt NT seq  +upstreamnt  +downstreamnt
atgaatcaaaaaattcttgttattaatggaccaaatctgaacttgcttggaacaagagaa
aaagaaaagtacggaaaatcttcacttgaggatataaaaaataaatgtgaatcatattct
aaaaagattggtttagaagtcgagtttagacagtcaaatgttgaaggtgaaatagtaaat
tttatccaagatagtagtaaaaactatgagggcattatcattaatgctggtggatacacc
cacacatctgtagcaatacttgatgcgttacttgcggttaaaaaaccaactattgagtta
catataacaaatatttacaaaagagaggatttcaggcataaatcactaattagcaaagct
gctgatggaataatttgtggtttgggtgtt

KEGG   T31013 (Metagenome): 23957Help
Entry
23957             CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold34263_1_gene23957
Definition
strand:+ start:1177 stop:1626 length:450 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
woc:BA177_14800 (best score: 199.519)
Taxonomy
Gammaproteobacteria - Others [GN:woc]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 149 aa AA seqDB search
MSKLLLINGPNLNLLGTREPDVYGDTDLKEVERSLKETAAKLNHTLECFQSNAEHAIVDR
IQKAAKDKIEFILLNPGAFTHTSISIRDALLAIDVPFIEIHLSNTFAREEYRQTSYFSDI
AAGCLFGLGKYGYELALRAAAKQLLAPED
NT seq 450 nt NT seq  +upstreamnt  +downstreamnt
atgtcaaagctactactgattaatggccctaatctaaatcttcttggtacaagagagcct
gatgtttatggagatacagatcttaaagaagttgaaagatctcttaaagaaactgctgca
aaactcaaccatacccttgagtgttttcaaagcaatgccgaacatgcaattgttgatagg
atacaaaaagcggctaaagataaaattgaatttattttactaaacccaggcgcttttact
catacgagcatatcaatacgcgatgcacttcttgcgattgatgtgccctttattgagatt
cacctcagtaatacatttgcaagagaagagtatcgtcaaaccagctactttagtgatatt
gctgcaggatgtttatttggtctgggaaaatacggttacgagttagcgcttcgagcagct
gcaaaacaactactagctcctgaggattag

KEGG   T31013 (Metagenome): 250026Help
Entry
250026            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold254365_1_gene250026
Definition
strand:- start:3 stop:329 length:327 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
mex:Mext_1094 (best score: 134.806)
Taxonomy
Alphaproteobacteria [GN:mex]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 109 aa AA seqDB search
VKVLFLNGPNLNLLGQREPEIYGSMTLTDIEDMVREHADRHNVEVVFHQSNHEGELVTQV
QQSAGDYDYVILNAAAYTHTSIALKDAIVGSGANAIEIHLTNVHAREAY
NT seq 327 nt NT seq  +upstreamnt  +downstreamnt
gtgaaggtattattcctcaacggccccaacctgaacctgctgggccagcgcgaaccggag
atttacggcagcatgacgctgacggacatcgaggacatggttcgtgaacacgccgaccgg
cacaacgtcgaggtcgtgtttcaccagtccaaccacgagggcgaactggtgacacaagtg
caacagtcagccggtgactacgactatgtgatcctgaacgcggcggcgtacacccacacg
agcatcgcgctcaaggatgccatcgtcggctccggtgcaaatgccatcgagattcacctc
accaacgtccacgcccgcgaggcgtac

KEGG   T31013 (Metagenome): 250556Help
Entry
250556            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold254513_1_gene250556
Definition
strand:+ start:2389 stop:2835 length:447 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
ttr:Tter_1242 (best score: 155.992)
Taxonomy
Unclassified Terrabacteria group [GN:ttr]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 148 aa AA seqDB search
MASFLILNGPNINMLGRRDASIYGSKTMDEVNQEISRVAGELGVEVIFYQSNLEGKLVDC
VQEHWGKVQGIVLNPGALTHYGLSLKDALIDCRLPVIEVHLSNPGSREPWRRVSVISEIA
RGVVAGFGWRSYTAALQLLAGLVEEESK
NT seq 447 nt NT seq  +upstreamnt  +downstreamnt
atggccagcttcttgatattaaacggccccaacatcaacatgttgggccgccgtgatgca
tcgatctatggttcaaagaccatggacgaggtgaaccaagagatcagccgggtcgcggga
gagcttggcgtcgaggtcatcttctaccagtccaacctggaaggcaaattggtggactgc
gtccaagaacactggggcaaagtccaaggcatcgtgctcaatcccggcgctttgacccat
tacgggcttagcttgaaggatgctttgatcgactgccgcctgccggtgattgaagtccat
ctcagcaaccccggctctagagagccctggcgcagggtctcggtgatctcggagatcgcc
cgaggcgttgttgccggcttcggttggaggagctacacagcggccctgcaactactcgcc
ggtctcgttgaagaagaatccaaatga

KEGG   T31013 (Metagenome): 250692Help
Entry
250692            CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold254552_1_gene250692
Definition
strand:+ start:3250 stop:3696 length:447 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
ttr:Tter_1242 (best score: 153.68)
Taxonomy
Unclassified Terrabacteria group [GN:ttr]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 148 aa AA seqDB search
MVSFLILNGPNINMLGRRDTSLYGSKTLEEVNQEIKWVANELGVEVIFYQSNLEGELVNC
IQEHWGKIQGIVLNAGALTHYGLSLKDALIDSRLPVVEVHLSNPLAREDWRRVSVISDIA
RGQIAGFGWRSYTSALKVLSEVVEEESR
NT seq 447 nt NT seq  +upstreamnt  +downstreamnt
atggtcagtttcttgatcttaaacggccccaacatcaacatgctgggacgccgggacaca
tctctatacggctccaagaccctggaagaagtgaaccaggagatcaaatgggttgccaat
gaacttggcgtagaggtcattttctaccagtccaacctggaaggggaactggtcaactgc
atccaggagcattgggggaagatccaaggcatagtcttgaatgcaggagcactgacccac
tatgggctcagcctgaaagacgcattgatcgacagccgtttgccggttgtcgaagtccat
ctcagcaaccctttggccagggaagactggcgcagagtttcggtgatctcggacatagcc
agaggccagatcgctggatttggctggcgaagttacacctcggcgctaaaagtattgtct
gaagttgtcgaagaagaatccagatga

KEGG   T31013 (Metagenome): 259896Help
Entry
259896            CDS       T31013                                 

Gene name
133_MES_0d2-3_C21959026_1_gene259896
Definition
strand:- start:1 stop:285 length:285 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
cau:Caur_0393 (best score: 95.1301)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 95 aa AA seqDB search
VKILVVNGPNLNNLGKRDESHYGSELFSDVITAIEKFSKEAGVETICFQSNSEGELISFI
QNEASTSDGIVINAGALTHYGLSLRDSLIDAKIPL
NT seq 285 nt NT seq  +upstreamnt  +downstreamnt
gtgaaaatactggttgtcaatggacctaatcttaacaacttaggtaaaagagatgaatct
cattacgggtctgaattatttagtgacgttattacagcgattgaaaaattttccaaagag
gccggcgtcgaaacaatttgtttccaaagtaactcagaaggcgaattgattagttttatt
caaaacgaagcgtctacttcagatggtattgtgattaatgctggagctttgacccattat
ggattatctctcagggattcattgatagatgcaaaaatcccttta

KEGG   T31013 (Metagenome): 262302Help
Entry
262302            CDS       T31013                                 

Gene name
133_MES_0d2-3_C21964662_1_gene262302
Definition
strand:- start:2 stop:136 length:135 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
tta:Theth_0488 (best score: 44.2838)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 45 aa AA seqDB search
MNILIIQGPNLNLIGLSSAKIGEQVTLDKVNQGLRKQAHKRPEEI
NT seq 135 nt NT seq  +upstreamnt  +downstreamnt
atgaatatcttaattattcaaggaccaaatcttaatctcataggattaagttcagcaaaa
attggtgagcaagtaaccttagataaggttaatcaagggctgcggaaacaagcccataaa
agaccagaagaaatc

KEGG   T31013 (Metagenome): 262538Help
Entry
262538            CDS       T31013                                 

Gene name
133_MES_0d2-3_C21965228_1_gene262538
Definition
strand:- start:92 stop:508 length:417 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
hel:HELO_3975 (best score: 233.802)
Taxonomy
Gammaproteobacteria - Others [GN:hel]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 138 aa AA seqDB search
GPNLNLLGTRQPEIYGYDTLDDVNNLLREKAVMAGWEITCLQSNHEGALIDAIHAARVDG
TQAIIINPAAYTHTSVAILDALNAFDGKVIEVHLSNVHKRESFRHHSYVSLRADGVIAGL
GVQGYKAALEAVMAASHQ
NT seq 417 nt NT seq  +upstreamnt  +downstreamnt
gggcctaatctcaatttattaggcacgcgtcagccagagatttatggctatgacacactc
gacgatgtgaataacctgctgcgcgaaaaagcggtaatggcaggctgggagatcacctgc
ctgcaaagtaaccatgaaggtgcgctcatcgacgccattcacgcagcgagggtagatggc
acgcaggccatcattatcaatccggcggcctatactcatacctcggtagcgattctcgat
gcgttgaacgcctttgacggcaaggtcatcgaagtccatctctctaacgtgcataagcgc
gagtcgtttcgccaccactcctatgtctcgctacgggccgatggcgtgattgctggccta
ggcgtgcagggatataaagcggcgctagaggcggtgatggctgcctcccatcaataa

KEGG   T31013 (Metagenome): 264768Help
Entry
264768            CDS       T31013                                 

Gene name
133_MES_0d2-3_C21970648_1_gene264768
Definition
strand:- start:83 stop:511 length:429 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
lri:NCTC12151_02961 (best score: 177.563)
Taxonomy
Gammaproteobacteria - Enterobacteria [GN:lri]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 142 aa AA seqDB search
PNLNLLGTREPEIYGYDTLEDINGRLLGQAKDLGLELQFYQSNAEHELVEAVHRARTQAQ
FIIINPGAFTHTSVSLRDAFSAVQIPFIEIHLSNVFGREEFRKHSYLSEIAVGVISGLGS
LGYELALASASQQIRAAGGAEN
NT seq 429 nt NT seq  +upstreamnt  +downstreamnt
cctaatttgaatttgctgggcacaagagagccggaaatttatggctacgatactttagaa
gatattaatggccggttattgggtcaagccaaggaccttggcctcgagttacaattttat
caatcaaatgcagaacatgaactggtagaggctgtccaccgtgcgaggacccaggcccag
ttcattataattaatcctggcgcttttactcacaccagtgtttccctgcgggatgctttt
agcgctgtacagataccctttatagagattcatctttccaatgtgtttggtcgagaagaa
ttcagaaaacactcctatctgtcagaaattgccgtgggtgttatctcggggctaggttct
ttaggatacgaactggcacttgcgtctgcgagtcagcagataagggctgccggcggagct
gaaaattga

KEGG   T31013 (Metagenome): 267213Help
Entry
267213            CDS       T31013                                 

Gene name
133_MES_0d2-3_C21976474_1_gene267213
Definition
strand:- start:3 stop:185 length:183 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
tsn:W908_07680 (best score: 122.479)
Taxonomy
Gammaproteobacteria - Others [GN:tsn]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 61 aa AA seqDB search
MNIYVINGPNINLLGSREPEIYGHDTLDSISKECIKQGLKDGHDVKFMQSNYEGELVEWI
Q
NT seq 183 nt NT seq  +upstreamnt  +downstreamnt
atgaatatatacgttataaatggtccaaacataaacctgcttggttcacgtgaacctgag
atttatggccatgacacattagacagtatttcaaaggaatgcataaagcagggcctgaaa
gatggccatgatgttaaatttatgcagtctaattatgagggtgagctagttgagtggatc
cag

KEGG   T31013 (Metagenome): 267214Help
Entry
267214            CDS       T31013                                 

Gene name
133_MES_0d2-3_C21976474_1_gene267214
Definition
strand:- start:185 stop:514 length:330 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
tsn:W908_07685 (best score: 167.933)
Taxonomy
Gammaproteobacteria - Others [GN:tsn]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 109 aa AA seqDB search
LEFCQTDDEIELTNYLTKACKEFDALIVNPVGYSHASSLDFDIYTSSIETITLQNKPVIE
VHIANIFQKGINITTPIKVSEGNVGFVSGFGIHSYDLAIRAVNKKLRKN
NT seq 330 nt NT seq  +upstreamnt  +downstreamnt
ttggagttttgccaaactgatgatgagatcgagttaacaaattatttaacaaaggcttgt
aaagagttcgatgcattaatcgtcaaccctgttggttattctcatgcatcctctttagac
tttgatatatatacttctagtatagaaacaattactcttcaaaacaaaccagttattgaa
gtgcatattgcaaatatttttcaaaaaggaattaatatcactacgccaataaaagtttct
gaaggtaatgttggttttgtaagtggatttggtattcatagttacgatcttgctattagg
gcagttaacaaaaaactgagaaaaaattga

KEGG   T31013 (Metagenome): 269237Help
Entry
269237            CDS       T31013                                 

Gene name
133_MES_0d2-3_C21981423_1_gene269237
Definition
strand:+ start:294 stop:515 length:222 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
css:Cst_c05280 (best score: 95.5153)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 74 aa AA seqDB search
MRILIINGPNLNLLGKREPEVYGSETLDEIMEWLKTAPEAKEHELEHFQSNHEGAIIDRL
HNAMGQSDGIIINP
NT seq 222 nt NT seq  +upstreamnt  +downstreamnt
atgaggattcttatcataaacgggccaaacctgaacctgctgggcaagcgggaacccgag
gtttacggatcggaaactctggatgaaattatggaatggctcaaaacagcgcctgaggcg
aaggagcatgagttggagcatttccaatctaatcatgaaggagctatcatcgaccgactc
cataatgccatgggtcaatcagatggtataattatcaatccc

KEGG   T31013 (Metagenome): 269580Help
Entry
269580            CDS       T31013                                 

Gene name
133_MES_0d2-3_C21982225_1_gene269580
Definition
strand:- start:74 stop:511 length:438 start_codon:yes stop_codon:yes
gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
tsn:W908_07680 (best score: 233.802)
Taxonomy
Gammaproteobacteria - Others [GN:tsn]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 145 aa AA seqDB search
MNIYVINGPNINLLGTRETEIYGKDTLESITKDCQQQAFKDGHDVKFMQSNYEGEIVEWI
QDAITKKIDAIVINAAAYTHTSIAIHDALKSYSGYKVELHISNPHLRESFRHVSYISSVV
DAVVAGLGADGYRHVIELLVDRQKH
NT seq 438 nt NT seq  +upstreamnt  +downstreamnt
atgaatatttacgtcataaatggtcctaatataaatcttctcggcacacgtgagacggaa
atttatggcaaggatacgttagaaagtattacaaaggattgccaacagcaggccttcaaa
gacgggcatgatgtgaaatttatgcagtctaattatgaaggggaaattgtcgaatggatt
caagatgcaatcactaaaaagatcgacgcaatcgtaatcaatgccgctgcctatacccat
acatcaatagcgattcatgatgcattgaaatcctattcaggatataaagttgagctacat
atttcaaacccacatttgcgtgaatcatttcgccatgtttcttatatttcttcagttgtt
gatgctgttgttgctggattgggcgcagatggctatagacatgtaatcgaattattggta
gaccgacaaaagcactaa

KEGG   T31013 (Metagenome): 272486Help
Entry
272486            CDS       T31013                                 

Gene name
133_MES_0d2-3_C21989513_1_gene272486
Definition
strand:+ start:85 stop:507 length:423 start_codon:yes stop_codon:yes
gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
bsu:BSU24470 (best score: 162.155)
Taxonomy
Firmicutes - Bacilli [GN:bsu]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 140 aa AA seqDB search
MNLLIINGPNLNLLGQREPKIYGKESLQDILDDVFLYSKNHNINVEAFQSNHEGEIVDMI
QKSNDLYQGLIINPGALSHYSISIRDAISSISIPVVEVHLSNVFTREKFRNHSVISDVCS
KMVIGFGSSGYKIAVGYFIN
NT seq 423 nt NT seq  +upstreamnt  +downstreamnt
atgaatttattgattattaatggaccaaatttaaatttattaggtcaaagagaaccaaaa
atatacggtaaggaaagtttgcaagatattttggacgatgtttttttatattcaaaaaat
cataatattaatgttgaggcatttcaatctaatcatgaaggtgaaatagttgatatgatt
caaaaaagtaatgatctttatcagggattaattataaatccaggagctttaagtcattat
agtatttctatacgtgatgctatctcgtcaatttctattcctgtagtagaagttcatctt
tcaaatgtttttacaagagaaaaattcagaaatcattctgttatctctgatgtatgctca
aaaatggtaattggatttggttcaagtgggtataaaattgctgttggctattttataaat
taa

KEGG   T31013 (Metagenome): 283853Help
Entry
283853            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22016541_1_gene283853
Definition
strand:+ start:1 stop:420 length:420 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
pub:SAR11_0728 (best score: 199.519)
Taxonomy
Alphaproteobacteria [GN:pub]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 139 aa AA seqDB search
GPNLNLLGEREQSQYGKITFNDLENICLNESKKIGVKVHFFQSNIEGEIVTKIQNARKEF
DGIIINAAGYTHTSVSIRDALDIFKKPIIELHISNIYKREEFRQKSLISGVVNGIICGLG
SNGYILAINAMHDLLKDGN
NT seq 420 nt NT seq  +upstreamnt  +downstreamnt
ggtccaaatcttaatctattaggtgaaagagaacaatcccaatatggcaaaattacattt
aatgatttagaaaatatatgtttaaatgagtcaaaaaaaataggtgtaaaagttcatttt
tttcaatctaatattgaaggtgaaattgtaactaaaattcaaaacgcaagaaaagaattt
gatggaataattattaatgccgcaggttatacacatacatctgtttcaatcagagatgct
ctagatatatttaaaaaaccaataattgaactacacatttcaaatatatataaaagagaa
gaatttagacaaaaatcattaataagtggtgttgtgaatggaataatttgtggtctcggt
tcaaatggttatattttggccataaatgcaatgcatgacttgctaaaagatggaaattga

KEGG   T31013 (Metagenome): 285380Help
Entry
285380            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22020139_1_gene285380
Definition
strand:- start:326 stop:538 length:213 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
sjp:SJA_C1-33190 (best score: 123.635)
Taxonomy
Alphaproteobacteria [GN:sjp]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 70 aa AA seqDB search
LNPGGLTHTSVALHDAIKGITVPVIEVHLSNPHKREAFRHKSYVGMAAKGTVAGFGPMSY
MLALEAALEL
NT seq 213 nt NT seq  +upstreamnt  +downstreamnt
ctgaatcccggcgggctgacccacacgtcggtcgccctgcatgacgcgatcaagggcatc
accgtgccggtgatcgaagtgcatctgtccaacccgcacaagcgcgaggcattccgccac
aaaagctatgtcggcatggcggcgaagggcacggtcgcgggatttggcccaatgtcctac
atgctggcgttggaagccgcgctggaactgtaa

KEGG   T31013 (Metagenome): 287546Help
Entry
287546            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22025449_1_gene287546
Definition
strand:+ start:3 stop:269 length:267 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
hsw:Hsw_1856 (best score: 119.398)
Taxonomy
Bacteroidetes [GN:hsw]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 88 aa AA seqDB search
EGELIDKLQEVGFSYDYILLNAGGYTHTSVALADCIKAIDTPVTEVHISNIYAREDFRKK
SLLSENCKAVICGLGLDSYKAGLTILLN
NT seq 267 nt NT seq  +upstreamnt  +downstreamnt
gaaggggagctgattgacaagctgcaagaagttggtttttcgtacgattatattctactt
aatgcaggaggttatacgcatacctcagtagctttggctgattgtattaaagcaatagat
actccagtaacagaagtgcatatttcgaatatatatgcaagggaagattttaggaagaaa
tcacttttatctgagaattgcaaagcagtaatttgtggcttgggtttagactcttataag
gcaggattaacaattttgttaaattag

KEGG   T31013 (Metagenome): 292368Help
Entry
292368            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22037153_1_gene292368
Definition
strand:- start:80 stop:520 length:441 start_codon:yes stop_codon:yes
gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
amc:MADE_1019655 (best score: 266.159)
Taxonomy
Gammaproteobacteria - Others [GN:amc]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 146 aa AA seqDB search
MNILLLNGPNLNMLGQREPDKYGTQTLQDIVDDLQAQAASSNVTLTYFQSNAEFELIDRV
HAAMGTVDAIIINPAAFTHTSVALRDALLSVNIPFIEVHLSNVYAREPFRHHSYFSDVAA
GVIVGLGAMGYSLALTAAINLPKSQK
NT seq 441 nt NT seq  +upstreamnt  +downstreamnt
atgaatattttgttattgaacggccctaacttaaatatgttaggccaaagagaacccgac
aaatacggcacgcaaaccttgcaagacatcgttgatgatttgcaggcgcaggctgcgtcg
agcaacgtgacattaacgtattttcagtcaaacgcggagtttgaactgatcgatcgcgtg
cacgctgctatgggtactgttgatgccattattattaatcctgctgccttcacgcacacc
agcgtcgcccttcgcgatgcattattaagtgtcaatatcccgtttattgaagtgcatttg
tcgaacgtttacgctcgtgaaccttttcgtcatcattcttatttttctgatgttgcagct
ggcgtcattgttggccttggtgccatgggctactcgctcgcgcttactgcagcaatcaat
ttaccgaaatcgcaaaaataa

KEGG   T31013 (Metagenome): 297877Help
Entry
297877            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22050257_1_gene297877
Definition
strand:- start:3 stop:224 length:222 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
css:Cst_c05280 (best score: 84.7297)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 74 aa AA seqDB search
MKILILNGPNLNLLGIREPEIYGTETLDDISDWLNQQPDANPHDITWFQSNHEGDLIDQV
HESMNLFDGIILNP
NT seq 222 nt NT seq  +upstreamnt  +downstreamnt
atgaaaatcttgatattaaatgggcctaacctcaatttacttggcatacgggaacctgag
atctatggaacagaaacactggatgatattagcgactggctcaaccaacaaccggacgca
aacccgcatgatattacctggtttcaatcaaatcatgaaggagaccttatagatcaagtt
catgaatcaatgaatctatttgatggaatcattctaaatcca

KEGG   T31013 (Metagenome): 2992Help
Entry
2992              CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold4074_3_gene2992
Definition
strand:+ start:6692 stop:7117 length:426 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
tta:Theth_0488 (best score: 64.6994)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 141 aa AA seqDB search
MNILILHGPNLNLIGNISADLGKRMTLDKINTGIRRHVRNTETELKVCQTHKVYQAINFI
QRNRNWADSLLFAPMSWAQYEYSIGESISISGIKTVQLLFNDGYQQINEKDSIFSKIATK
TIIGKPDNVYIDGIKFLQNLT
NT seq 426 nt NT seq  +upstreamnt  +downstreamnt
atgaatattcttatcctgcacggtccaaaccttaatcttattggtaatatttctgccgat
ttaggcaaacgaatgactcttgataaaattaacacaggaataaggcgtcatgttaggaat
acagaaactgagttaaaagtatgtcaaactcacaaagtgtatcaggcaattaactttatt
caacgaaatagaaattgggccgatagtcttttatttgcacctatgtcctgggctcaatat
gaatattcaattggtgaatcaattagtatctctggtattaaaaccgtacagctattattt
aatgatggttatcaacaaataaatgaaaaagattcaatatttagtaaaatagcaactaag
acaataataggtaagccggataacgtatacatagatggcatcaaatttctacaaaatctc
acctga

KEGG   T31013 (Metagenome): 303558Help
Entry
303558            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22063917_1_gene303558
Definition
strand:- start:1 stop:117 length:117 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
hba:Hbal_1900 pla:Plav_3290 (best score: 48.9062)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 39 aa AA seqDB search
MKKIIIINGPNLNLLGNRETDIYGKTTLSEIEQLSKNKA
NT seq 117 nt NT seq  +upstreamnt  +downstreamnt
atgaaaaagattataattataaatggaccaaatcttaatttacttggaaatagggaaaca
gatatatatgggaaaacaacacttagtgagatagagcaactctcaaaaaataaagca

KEGG   T31013 (Metagenome): 308376Help
Entry
308376            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22075185_1_gene308376
Definition
strand:+ start:1 stop:477 length:477 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
lhk:LHK_00597 (best score: 187.963)
Taxonomy
Betaproteobacteria [GN:lhk]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 158 aa AA seqDB search
CHTAFFEVDRRRMPRILVLHGPNLNLLGTREPEIYGSATLEDINTELQRLATSRGVELTT
LQSNAESDLVEAIQNAANDDTGFIVINPAALTHTSVALRDALLAVDLPFIEVHLSNVYAR
ETFRHQSYLSDIATAVISGLGSAGYEYALSTAINTLEQ
NT seq 477 nt NT seq  +upstreamnt  +downstreamnt
tgtcatactgcgtttttcgaggtggatcgtcgtcgaatgccgaggatactggtattacat
ggccccaatctaaacctattgggcacgcgagaacctgagatctacggttccgccacgctg
gaagatatcaataccgaactgcaacggcttgcaacgtcgcgtggagttgagctgacaacc
ttgcagagcaatgcggaatcggatctcgtcgaggccattcagaatgcggcaaacgacgac
actggctttatcgtcatcaatccggcagcgttgacacacaccagtgttgcgcttcgcgat
gcgctattggcggtggatctaccatttattgaagtccacctatcgaacgtctacgcgcgg
gaaacgtttcgccatcagtcctacctctccgatattgcgacagcggtgatatcggggttg
ggctcggccgggtatgaatacgcgctcagtaccgcaatcaatacgctggagcaatga

KEGG   T31013 (Metagenome): 310410Help
Entry
310410            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22080091_1_gene310410
Definition
strand:+ start:132 stop:557 length:426 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
moc:BB934_01675 (best score: 174.096)
Taxonomy
Alphaproteobacteria [GN:moc]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 141 aa AA seqDB search
MKVLFLNGPNLNLLGKRQPEIYGVTTLTDIESTVREQAEDRAEIEFRQSNDEGALVTWIQ
EAAGQTDVVVINAAGYTHTSVALRDAIAATDVPVVEIHLSNIHAREEFRHNSLIAPVCQG
QICGFGPTSYMLGFEAALSLK
NT seq 426 nt NT seq  +upstreamnt  +downstreamnt
atgaaggttcttttccttaatgggccgaatctaaacctgctcgggaaacgccaaccggaa
atttacggtgttacgacgcttactgacattgaatcgaccgtgcgcgaacaggcagaagac
cgcgccgaaattgagtttcgacaaagtaatgatgaaggagcactagttacctggattcag
gaagctgcaggccaaactgatgtggtggtaatcaacgctgcgggatacacacacaccagc
gtagctctgcgcgatgccatcgccgccaccgatgtgccggtcgttgagattcacctctcc
aatattcacgctcgcgaagaattccgacacaattctctcatcgccccggtctgtcagggc
caaatctgtgggtttggcccaacatcctacatgttaggatttgaggcagctttatcatta
aagtaa

KEGG   T31013 (Metagenome): 32453Help
Entry
32453             CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold44130_1_gene32453
Definition
strand:+ start:204 stop:644 length:441 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
caby:Cabys_3745 (best score: 80.8777)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 146 aa AA seqDB search
MNLLIIQGPNLNLLGKKSSQAGECITLDKINKALRLLVRNQNINLKFLQTHKIERVITSL
QRNRNWADGILIAPMAWAKFEYVLKETLQLIKLPVVEIFFNEAFFMGTGKKDSMLTETCI
ESIEGFPEEVFTDGINRLIHHIQKPV
NT seq 441 nt NT seq  +upstreamnt  +downstreamnt
atgaaccttctaataatacagggacctaatcttaatcttttaggtaaaaaatcttctcag
gctggagaatgcattactttagataaaataaataaagcccttcgtcttctagtaagaaac
cagaacattaatttaaaatttcttcagacccacaaaattgaaagggtcattacttcacta
caaagaaaccgaaactgggccgatggaatccttattgcacctatggcctgggcaaaattt
gaatatgttctaaaagaaacgctccaattaattaaacttcctgtggtagaaatattcttt
aatgaagccttctttatgggcactgggaaaaaagattctatgctcaccgagacctgtatt
gaatccatagaaggttttcctgaagaagtgtttactgatggaataaatcgtttaatccac
catatacaaaaacctgtttaa

KEGG   T31013 (Metagenome): 326272Help
Entry
326272            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22118022_1_gene326272
Definition
strand:+ start:1 stop:297 length:297 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
hel:HELO_3975 (best score: 179.489)
Taxonomy
Gammaproteobacteria - Others [GN:hel]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 98 aa AA seqDB search
ASRQSNHEGELIDAIHAARLDGTVAIIINPAAYTHTSVAILDALNAFDGTVIEVHLSNVH
KRESFRHHSYVSLRADGVIAGLGSQGYHAALDAVIRKG
NT seq 297 nt NT seq  +upstreamnt  +downstreamnt
gccagtcgccagagcaatcacgagggtgagctgatcgacgccatccacgccgcgcgcctc
gatggcaccgtcgccatcatcatcaaccctgcggcctatacccacacctcggtggcgatc
ctcgatgccctgaacgccttcgatggcacggtgatcgaggtgcatctgtccaacgtgcac
aagcgcgagagctttcgccaccactcctacgtctcgctgcgcgccgatggcgtcatcgcc
gggctcggcagtcagggctaccacgccgccctggacgcggtgatcaggaaagggtga

KEGG   T31013 (Metagenome): 331276Help
Entry
331276            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22129932_1_gene331276
Definition
strand:+ start:2 stop:106 length:105 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
psin:CAK95_25205 (best score: 48.1358)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 34 aa AA seqDB search
FRHSSYISKGVNGVVCGFGLNGYLLAIDGINKLI
NT seq 105 nt NT seq  +upstreamnt  +downstreamnt
tttagacacagctcttatatcagtaagggagtaaatggcgtggtttgtggatttggatta
aatggctacttacttgctattgatggaatcaacaaattaatataa

KEGG   T31013 (Metagenome): 341921Help
Entry
341921            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22155170_1_gene341921
Definition
strand:- start:1 stop:252 length:252 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
tta:Theth_0488 (best score: 58.151)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 84 aa AA seqDB search
MNILILQGPNLNLLGLKSASIGDSLTLDKFNRAIRLHLRNTKNKLKIIQTHKEYLALNFI
QRNRNLAKGLVIIPTSWAKYNQTI
NT seq 252 nt NT seq  +upstreamnt  +downstreamnt
atgaacatactaatattacaagggccaaatcttaatcttcttggattaaaatctgctagc
attggtgattcactaacgctagataagtttaatcgagcaattcgattacatcttagaaat
accaaaaacaaactaaagattattcaaacacataaagaatatctagcacttaattttatt
cagaggaatcgaaacctggcaaaaggtttagtaattattccaacatcttgggcaaagtat
aatcaaactata

KEGG   T31013 (Metagenome): 344869Help
Entry
344869            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22162196_1_gene344869
Definition
strand:- start:481 stop:669 length:189 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
lep:Lepto7376_2679 (best score: 100.138)
Taxonomy
Cyanobacteria [GN:lep]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 62 aa AA seqDB search
RDAITAVGLPAIEIHLSNVHARENFRRHSYIAPVALGQICGFGSNGYILGLRALIDHLNS
KE
NT seq 189 nt NT seq  +upstreamnt  +downstreamnt
cgggatgccattactgcagtggggctcccggcgattgagatccacctgtcgaatgtccat
gccagggaaaacttccggcgtcattcatatatcgcaccggtggcattaggtcagatctgc
ggatttggttcgaatggttatatcctgggattacgcgctttaattgatcatctaaattcg
aaggagtaa

KEGG   T31013 (Metagenome): 350729Help
Entry
350729            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22176266_1_gene350729
Definition
strand:+ start:1 stop:408 length:408 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
tte:TTE1279 (best score: 105.145)
Taxonomy
Firmicutes - Clostridia [GN:tte]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 135 aa AA seqDB search
IQGAGMNMRGKVQLETFGPMTLEEMNEQILGYAESLGMDIELMHSNIEGEVVNALYDAHD
RNFDAALINPAGYTTTTGPIKGAISQVKFPVIEVHASNPTARGTVSQVLPVCKGAVYGFG
VYGYKLALEAVKQMA
NT seq 408 nt NT seq  +upstreamnt  +downstreamnt
atccaaggcgcgggcatgaatatgcgcggaaaggtccaactggagacctttggtcccatg
accctggaagagatgaacgagcagatcttgggttacgcggaaagcctgggcatggacatc
gagttgatgcattcgaatatcgagggcgaagtggtgaatgctttatacgacgcccatgac
cggaattttgatgccgcgctgataaacccggccggctacaccacgaccaccggaccaata
aagggagctatctctcaggtgaaattcccggtgatcgaagtgcacgcttccaacccgacc
gccagggggaccgtctctcaggtgcttcccgtctgcaaaggcgcggtgtacggctttggt
gtctacggatataaactagccttggaagcggtcaaacagatggcctaa

KEGG   T31013 (Metagenome): 356533Help
Entry
356533            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22189952_1_gene356533
Definition
strand:- start:1 stop:414 length:414 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
rru:Rru_A2433 (best score: 150.214)
Taxonomy
Alphaproteobacteria [GN:rru]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 138 aa AA seqDB search
MKKILILNGPNLNLLGNRETDVYGEKSLNDIKQICEEKCNLLKLSCDFIQSNNEGELISL
IQLVENDFEGLIINPAAFTHTSVAILDALRAISKPKIEIHLSNIYTREEYRKKSITSEAV
NGVICGFGANSYILAIEA
NT seq 414 nt NT seq  +upstreamnt  +downstreamnt
atgaaaaaaatacttatactcaatgggccaaatttaaatttattaggcaaccgtgaaact
gatgtctacggtgaaaaatctttaaatgatatcaaacaaatttgtgaagaaaaatgtaac
ttacttaaattaagttgtgattttattcaaagtaacaatgaaggagaattaataagctta
atacagttagtagaaaatgattttgaaggtttaattattaatccagcagcttttacacat
acttctgttgcaatcttagacgctttgcgagcaatatccaaaccgaaaattgaaattcat
ctatcaaacatatacactcgcgaagaatatagaaaaaaaagtattacatctgaggctgta
aatggtgttatttgtggttttggtgcaaatagttatatccttgcaattgaagcg

KEGG   T31013 (Metagenome): 361269Help
Entry
361269            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22201162_1_gene361269
Definition
strand:+ start:61 stop:480 length:420 start_codon:yes stop_codon:yes
gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
lby:Lbys_1515 dfe:Dfer_2796 (best score: 181.03)
Taxonomy
Bacteroidetes [GN:lby]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 139 aa AA seqDB search
MKLIIINGPNLNLLGIREKKIYGSISFESYFKILKKKYSKIQLEYYQSNHEGELIEKIQE
TGFDYDGIIINAGGFTHTSIALRDAISSINSPAVEVHISNILSREEFRKKSYLSDVCEGI
ISGLGLIGYDFAINYFYSK
NT seq 420 nt NT seq  +upstreamnt  +downstreamnt
atgaaattaataattattaatggtccaaatttaaatcttctaggtataagagaaaaaaaa
atatatggaagtatttcatttgaatcatattttaaaattttaaaaaaaaaatattccaaa
attcaacttgaatattatcaatctaatcatgagggagaactaatagaaaaaatacaagaa
actggctttgattatgatggaataattattaatgcaggaggatttactcacacctctata
gctttaagagatgctatttcttctattaattcaccagctgttgaagtacacatttccaat
atactttcaagagaagaatttagaaaaaaaagctacttaagtgatgtgtgtgagggaatt
atatcaggactaggattaattggatatgattttgctattaattatttttattccaaataa

KEGG   T31013 (Metagenome): 366607Help
Entry
366607            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22213828_1_gene366607
Definition
strand:+ start:384 stop:749 length:366 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
abo:ABO_2008 (best score: 204.912)
Taxonomy
Gammaproteobacteria - Others [GN:abo]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 122 aa AA seqDB search
LASILVLHGPNLNLLGRREPDQYGAATLAEIDQALMDQAAEAGHHLQHLQSNAEYELIER
IHGAPAEGIDFILFNPAAFTHTSVALRDALLAVRIPFIEVHLSNVHRRETFRHHSYFSDI
AE
NT seq 366 nt NT seq  +upstreamnt  +downstreamnt
ttggctagcatcctcgtcctgcacgggcccaacctgaacctgctgggccgccgcgagccg
gaccagtacggcgccgccaccctggcggagatcgatcaggcactgatggaccaggccgcc
gaggccggacaccacctgcagcatctgcaaagcaacgccgagtacgaactgatcgaacgc
atccacggcgcccccgcggaaggcatcgatttcattctgttcaacccggccgcgttcacc
cacaccagcgtggcactgcgcgacgctctgctggcggtgcggattccgttcatcgaggtg
cacctgtccaacgtgcaccgccgtgaaaccttccggcaccactcttacttctccgacatc
gccgag

KEGG   T31013 (Metagenome): 36670Help
Entry
36670             CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold48762_2_gene36670
Definition
strand:- start:2707 stop:3141 length:435 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
gei:GEI7407_0010 (best score: 169.088)
Taxonomy
Cyanobacteria [GN:gei]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 144 aa AA seqDB search
MKIAVIHGPNLRSLGKREPEVYGTDTLEDINDHLQKMANELGVEITVFQSNHEGELIDYI
ERMAPEVEGFLINPGAYTHTSIALRDAFVGVERSFVEVHLSNTTARERFRRHSYLAPVAA
GMVYGFGLHSYLLGLQGLVAKLQR
NT seq 435 nt NT seq  +upstreamnt  +downstreamnt
atgaaaattgcagtcattcacggtccgaatctccggtcactgggtaaaagggagccggag
gtttatgggaccgacacacttgaagatatcaatgaccacttgcagaaaatggcaaatgag
ttgggagttgagattacggtgttccagtctaaccatgaaggtgaattgattgattatatt
gagcgcatggctccggaggttgagggcttcttaattaatccaggtgcgtacactcatact
tcaatcgcgcttagggacgctttcgtgggtgtggagaggtctttcgttgaggttcacctt
tcgaataccacagcccgtgagcgttttcgccggcattcttatcttgcccctgttgctgcg
ggtatggtttatggctttggtctccatagctatcttctaggccttcaaggccttgtggct
aagttacagcggtag

KEGG   T31013 (Metagenome): 367078Help
Entry
367078            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22214906_1_gene367078
Definition
strand:+ start:268 stop:708 length:441 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
pnu:Pnuc_0211 (best score: 166.392)
Taxonomy
Betaproteobacteria [GN:pnu]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 146 aa AA seqDB search
LSDILIINGPNLNLLGTREPEVYGTESLADIEIKLNEIATSAKISLTFLQSNAEHEIIDV
IQSAKKNGVKFIIINPGPLTHTSIALRDTFLSTQIPFIEVHISNIFKREEFRKKSFLSDI
SHGLIAGLGSNGYEYALLEAMGNIKN
NT seq 441 nt NT seq  +upstreamnt  +downstreamnt
ttgtctgatattttaatcattaatggaccaaaccttaatcttctaggaactagagaacct
gaggtatatggaactgaatctcttgctgatatagaaattaaactaaatgaaattgcaaca
tcagcaaaaatatcattaacatttttacaaagtaacgctgaacatgaaattattgatgta
attcaatccgcaaaaaaaaatggggttaaatttattattattaacccaggcccacttact
catacaagtatagccttaagggatacttttttaagcactcaaattccatttattgaagtt
catatatctaatatttttaagagagaagaatttagaaaaaaatcttttctgagcgatatt
agtcatggattaatagctggattgggatctaatggctatgaatatgctttacttgaagca
atggggaatattaagaattaa

KEGG   T31013 (Metagenome): 368020Help
Entry
368020            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22217220_1_gene368020
Definition
strand:- start:1 stop:279 length:279 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
tsn:W908_07680 (best score: 151.369)
Taxonomy
Gammaproteobacteria - Others [GN:tsn]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 93 aa AA seqDB search
MKVYVINGPNINLLGTREPEIYGYETLDDIAKKCIENGNKKGIDVKFMQSNYEGELVGWI
QDAIKNKIDAIVINAAAYTHTSIAIHDAFKSFS
NT seq 279 nt NT seq  +upstreamnt  +downstreamnt
atgaaagtatacgtaattaatggtccaaatatcaatttactcggaactcgtgagcccgaa
atttacggctatgaaacgctcgatgatattgcaaaaaaatgtatagaaaatggtaataag
aaaggtattgatgtcaagttcatgcaatcaaattatgaaggtgaattagttggatggatt
caagatgcaataaaaaataaaattgatgctatagttataaatgcagctgcatatactcat
acctccattgcaattcatgatgctttcaagtcgttttct

KEGG   T31013 (Metagenome): 368021Help
Entry
368021            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22217220_1_gene368021
Definition
strand:- start:285 stop:755 length:471 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
tsn:W908_07685 (best score: 165.236)
Taxonomy
Gammaproteobacteria - Others [GN:tsn]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 156 aa AA seqDB search
NMKNKLLILNGPGLSDLSVYDEFYGEITLKEIEKKCTEVCSEHNIELDFRQTDDEDELFG
FLLKDSEKFDAVIINPVGYSHALTAEFARYRLAIKTLTLQKKPVTEVHIANIFKQGSDIT
KPLQVPEGEMGFVSGLGVYSYVIAINAISKKLNQHT
NT seq 471 nt NT seq  +upstreamnt  +downstreamnt
aatatgaaaaacaaattattaattttaaacggcccaggtctatcagacttaagtgtttat
gatgaattttatggtgaaattactcttaaagaaatagaaaagaaatgcacagaagtgtgt
agtgaacataatattgagctggattttcgtcaaactgatgatgaagatgaattgtttggt
tttttactcaaggattctgaaaaatttgatgcagtgattattaatcctgttgggtattct
catgcattgactgcagaatttgcaagatacaggctcgcaataaaaacactgactcttcaa
aaaaagccagtaacagaagttcatattgctaatattttcaaacagggctcagatataaca
aaaccattacaggtgcctgaaggagagatgggatttgttagtggtcttggtgtttatagc
tatgtaattgctatcaatgctatttcaaaaaaacttaatcaacatacataa

KEGG   T31013 (Metagenome): 373037Help
Entry
373037            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22228742_1_gene373037
Definition
strand:+ start:3 stop:89 length:87 start_codon:no stop_codon:yes
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
rgi:RGI145_19290 (best score: 35.4242)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 28 aa AA seqDB search
VASGVVLGFGSQGYLLALRGLVARITGE
NT seq 87 nt NT seq  +upstreamnt  +downstreamnt
gtagccagcggggtggttctaggttttggatctcagggctatcttctagcgctgagaggg
ctcgtggcccgaatcaccggcgagtaa

KEGG   T31013 (Metagenome): 374015Help
Entry
374015            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22231054_1_gene374015
Definition
strand:- start:3 stop:398 length:396 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
tta:Theth_0488 (best score: 84.3445)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 132 aa AA seqDB search
MKILVLHGPNLNLLGSISIHAKQRTTLDKINKALRLHVRNSEINLKISQTHKVFQAINFI
QRNRNWADGFLFAPMAWARYEYSILDALKVSDIPSVQLLFSNGFDDIEEKSSIFSNLCHS
TIIGDPNQIYID
NT seq 396 nt NT seq  +upstreamnt  +downstreamnt
atgaaaattcttgtattacacggacctaacctgaatttgctcggatctatctctatccat
gcaaaacaacggacaactttggataaaataaataaagctcttcgtcttcatgttaggaat
tcagaaattaatttaaagataagccaaacccataaggtattccaggctatcaattttatt
caacgtaatcgcaattgggctgatgggtttctttttgctccaatggcctgggctcgatat
gaatactctatcttggatgccctaaaggtttcggatattccatccgttcaattattattt
tcaaatggttttgatgatatagaagaaaaatcgtcaatcttttccaatttgtgccattcc
accattattggtgatcccaatcaaatatatattgat

KEGG   T31013 (Metagenome): 385576Help
Entry
385576            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22258210_1_gene385576
Definition
strand:+ start:211 stop:651 length:441 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
sjp:SJA_C1-33190 (best score: 267.314)
Taxonomy
Alphaproteobacteria [GN:sjp]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 146 aa AA seqDB search
VADARKIYVLNGPNLNMLGTREPEIYGYDTLDDIAQRMEDAANRAHVEIDFRQSNHEGHL
VDWLQEAHAEGAHALIINPGAYTHTSIALHDAIKGISVPVIEIHLSNPHAREPFRHKSYV
GMAAKGTIAGFGPMSYMLALEAALEL
NT seq 441 nt NT seq  +upstreamnt  +downstreamnt
gtggccgacgcacgcaaaatctatgtgctcaatggacccaatctcaacatgctcggcacg
cgcgagccggagatttacggctatgacacgctcgacgacatcgcccagcgcatggaggac
gcggccaatcgcgcccatgtggaaatcgacttccgccagtccaatcacgaaggccatctg
gtcgactggttgcaggaagcccatgcggaaggcgcgcatgccctcatcatcaatcctggc
gcctatacccacacatccatcgcgctgcatgacgcgataaagggcatcagcgtgccggta
atcgaaattcacctgtccaacccgcatgcgcgtgagcctttccgccacaaaagctatgtc
ggcatggcggcgaagggcacgatcgcgggctttggccccatgtcctacatgctggcgctg
gaagccgcgctggaattatga

KEGG   T31013 (Metagenome): 395185Help
Entry
395185            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22280654_1_gene395185
Definition
strand:- start:50 stop:490 length:441 start_codon:yes stop_codon:yes
gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
amc:MADE_1019655 (best score: 253.832)
Taxonomy
Gammaproteobacteria - Others [GN:amc]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 146 aa AA seqDB search
MNILLLNGPNLNMLGQREPDKYGSQTLQDIVDDLQAQAESSDVTLSHFQSNAEHELIDCI
HNAMGNIDAIIINPAAFTHTSVALRDALLSVSIPFIEVHLSNVHGREPFRHHSYFSDVAA
GVIVGFGAIGYSLALTAAINLPKSQN
NT seq 441 nt NT seq  +upstreamnt  +downstreamnt
atgaatattttgttactaaatggccctaacctaaatatgttaggacaacgtgaacctgat
aagtacggctcgcaaaccttgcaagacatcgtggatgatcttcaagcgcaagctgagtca
agtgatgttacgcttagtcactttcagtcgaatgctgagcacgagcttattgactgtatt
cacaatgcaatggggaacatagatgccattattattaaccctgctgctttcacgcacacc
agtgtagcccttcgcgacgcactgttaagtgtcagtattccatttattgaagtgcacctg
tctaacgtacacggtcgcgaaccgtttagacaccactcctatttttctgatgttgcagct
ggcgtcatcgttggctttggcgcaataggctattcacttgcgctaactgcagcaatcaat
ttaccgaaatcgcaaaattaa

KEGG   T31013 (Metagenome): 40719Help
Entry
40719             CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold53650_1_gene40719
Definition
strand:+ start:578 stop:1006 length:429 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
ele:Elen_2547 (best score: 166.777)
Taxonomy
Actinobacteria [GN:ele]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 142 aa AA seqDB search
MRVLIINGPNLNLLGKREPDIYGKQTLNDIETWFNNLDYVKLHTIYWFQSNHEGKIIDRL
HESMNNTDGIIINPGAFTHYSYSIRDAIAAIDIPTVEVHLSDINNREKFRRISVINDVCV
AQVSGLGKKSYSEALKILTTES
NT seq 429 nt NT seq  +upstreamnt  +downstreamnt
atgagagtattaattataaacggccctaatctaaatttattagggaaacgagagccagat
atctatggcaaacaaacgcttaatgatattgaaacttggtttaataatctggactatgtc
aaactccatactatatactggttccagtctaaccatgaaggtaagattatagataggctt
catgagtcaatgaataatacggatggaattattattaatcctggcgcgtttacccactat
tcatattccataagagatgccatagctgccatagatatcccaacagtagaggtgcaccta
agtgacattaataatagagaaaaattcagaaggatatccgttataaatgatgtctgcgta
gcccaggtatcaggattaggtaaaaaaagttactcggaagcactcaaaatcctgactaca
gagtcttaa

KEGG   T31013 (Metagenome): 412554Help
Entry
412554            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22321026_1_gene412554
Definition
strand:- start:717 stop:1103 length:387 start_codon:no
stop_codon:yes gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
cmiu:B1H56_04455 (best score: 137.117)
Taxonomy
Firmicutes - Clostridia [GN:cmiu]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 128 aa AA seqDB search
GEREPEIYGSDTLDEINDWIKNHDICQNLDLEFFQSNSEGAIIDFLHSKRKEVNHLVINP
GALTHYSYALRDAIAGTNMKAVEIHLSDIHNRENFRKISVIKSVCLAQVVGEGKQGYITA
IKHILETK
NT seq 387 nt NT seq  +upstreamnt  +downstreamnt
ggtgaaagagaaccagagatctatggttctgataccttagatgagattaatgattggatt
aaaaatcacgatatttgtcagaatctcgatttagaattttttcaatcgaattctgaagga
gcaattattgattttcttcattctaagagaaaagaagtcaatcatctggtgattaatcct
ggagcattaacacattattcttatgcgcttagggatgccattgctggcacaaatatgaaa
gctgttgagatccacttgtctgatattcataatcgtgaaaattttagaaaaatttcagtt
attaaaagtgtttgtttggcccaagttgttggtgagggaaaacaaggatacataacagca
attaagcatatattggagacaaaatga

KEGG   T31013 (Metagenome): 420144Help
Entry
420144            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22338486_1_gene420144
Definition
strand:- start:87 stop:281 length:195 start_codon:yes stop_codon:yes
gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
chk:D4L85_14870 (best score: 55.8398)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 64 aa AA seqDB search
MNMNTGEIINKLREVGISFDAMVMNARAYTHTSVGIGDGIAGIGSSVIVVHISKLPIQHC
PPLS
NT seq 195 nt NT seq  +upstreamnt  +downstreamnt
atgaatatgaataccggtgaaatcattaacaagctgcgcgaagtaggcattagttttgat
gccatggtaatgaatgctagagcctatacccatacctctgttggcataggagatggcatt
gcaggtataggaagttcagtaatagtagtgcatatttctaagctccccatacaacattgc
cctcccctatcatga

KEGG   T31013 (Metagenome): 423767Help
Entry
423767            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22346550_1_gene423767
Definition
strand:+ start:244 stop:675 length:432 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
tta:Theth_0488 (best score: 72.7886)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 143 aa AA seqDB search
MEILVLQGPNLNLIGVQSAKVGERVTLDKINKGLRQHAHDISLDLRLRFLQTHKVEKAVS
FIHRNRKKAQGMILAPASWGHYEYSILDALQLSNLPSIQVLFEDDYGSLDKADSIFTSEC
TDTATGHPMEVFNAALDLLLKLT
NT seq 432 nt NT seq  +upstreamnt  +downstreamnt
atggaaattctggtattacaaggccctaacctgaatcttattggtgttcaatcagcaaaa
gtcggtgaacgcgtaaccttagacaaaattaataaaggtctgcgtcaacatgcccatgat
attagtttggacttacggctgcgttttttgcaaacccacaaagttgaaaaagctgtttca
ttcatccatcgcaatcgaaaaaaagcacagggaatgattttagctcctgcttcctggggc
cactatgaatattcaattttagacgcattacaattatccaacttgcccagtattcaagta
ttgttcgaagatgattatggatctttggacaaagcggactcaatatttacatcagaatgt
accgataccgcaactgggcaccccatggaagtgtttaatgctgctttagatttattatta
aaactcacctaa

KEGG   T31013 (Metagenome): 425229Help
Entry
425229            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22349964_1_gene425229
Definition
strand:+ start:726 stop:1166 length:441 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
pspi:PS2015_513 (best score: 191.43)
Taxonomy
Gammaproteobacteria - Others [GN:pspi]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 146 aa AA seqDB search
MASILALHGPNLNLLGSREPHIYGYDTLDDINSRLATQCAAAGHQFDAMQSNAEAELIER
LHIARKDGTAFMIVNFGGFTHTSIALRDAILASEIPFIEVHLSNLFKREEYRQKSYFSDI
AVGCIVGLGAQGYEFALTAACKTLAD
NT seq 441 nt NT seq  +upstreamnt  +downstreamnt
atggcatctattctggccttacatgggcctaatctgaatctcctcggtagccgtgagcct
catatttacggttatgacaccctggatgacatcaatagccgactagccacccagtgtgcc
gcagcgggccaccaattcgatgccatgcagagcaatgcggaggctgagcttatcgagcgc
ctgcacatcgcgcgcaaagatggaactgccttcatgatcgtcaatttcggcggcttcacc
cacaccagcattgccttgcgggacgcgatcctggccagcgaaataccttttatcgaagta
cacctctccaacttgtttaaacgggaagagtatcgacaaaaatcctatttttcagacatc
gcggtgggttgcatcgttggtctaggcgcgcaaggctacgaatttgcgctcacggctgca
tgtaagacactggcagactag

KEGG   T31013 (Metagenome): 428853Help
Entry
428853            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22357876_1_gene428853
Definition
strand:+ start:452 stop:904 length:453 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
abai:IMCC26256_111019 (best score: 177.948)
Taxonomy
Actinobacteria [GN:abai]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 150 aa AA seqDB search
MSTMSEQPLLLLSGPNLNLLGERQPDVYGSDTLDDHVEAARVAAAARGLVLEHLQSNHEG
EMVDAIHGARGRCAGIVVNPGAFTHYAWAIHDALAAFEGPVVELHLSNPAAREPWRHTSV
VAPVAAGTIAGFGGAGYRMAVEAVADLLDG
NT seq 453 nt NT seq  +upstreamnt  +downstreamnt
atgtcgaccatgagcgaacaaccgctgttgctcctgtcgggcccgaacctcaacctcttg
ggggaacgccagcccgacgtctacggcagcgacaccctggacgaccacgtggaggccgcc
cgggtcgccgcggccgcccgcggcctggtgctcgagcacctccagtccaaccacgagggc
gagatggtggacgccatccacggggcgcggggccgctgtgcgggcatcgtcgtgaacccc
ggggcgttcacccactacgcgtgggccatccacgacgccctggctgccttcgagggcccg
gtggtcgagctccacctctcgaaccccgccgcccgagagccgtggcgccacacctcggtc
gtcgcaccggtcgccgccggaaccatcgccggcttcggcggggccggctaccggatggcc
gtcgaagcggtggccgacctcctcgacgggtga

KEGG   T31013 (Metagenome): 430591Help
Entry
430591            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22361558_1_gene430591
Definition
strand:- start:359 stop:793 length:435 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
mmb:Mmol_0157 (best score: 179.874)
Taxonomy
Betaproteobacteria [GN:mmb]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 144 aa AA seqDB search
MKIKNITVIHGPNLNLLGKREPDHYGTLTLGDINIVLTNEATKLKLNVDVYQSNSESEIV
DKIQSLKSDFIIINPAAYTHSSVAIRDALAAMKIPFIEVHISNVFSREDFRKQSFFSDIA
VGVISGLGTEGYCAALNYAAKLNK
NT seq 435 nt NT seq  +upstreamnt  +downstreamnt
atgaaaataaaaaatattactgttattcatggtccaaacttaaacctcctgggcaaacgt
gagccggatcattatggaactcttacattaggcgatattaatatcgtccttacaaacgaa
gcgactaaattaaagctcaatgtagatgtttatcaaagtaatagtgaatcagaaattgta
gataaaattcaatccctgaaaagtgattttattattatcaatcctgcggcatatacgcat
agttcagttgctattcgagatgcgcttgctgcgatgaaaataccatttattgaagtacat
atttctaatgtattttcccgtgaagattttagaaagcaatcttttttctctgatattgca
gtcggtgttatcagtggattaggtactgaaggatattgtgctgccttaaattatgcagcc
aaattaaataaataa

KEGG   T31013 (Metagenome): 432661Help
Entry
432661            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22366030_1_gene432661
Definition
strand:- start:538 stop:1014 length:477 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
tta:Theth_0488 (best score: 102.834)
Taxonomy
Thermotogae [GN:tta]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 158 aa AA seqDB search
LHLKVGNRKAEEKMNILVLHGPNMNLIGVRASSIGENVTLDKINTALRREARQKKVTLKI
LQTDNISKAMTFIKRKRKWADGCLISPGAWARNGFDLLDTIQLCQLPTVEVHFSSDYDPS
NFAASSIISDSCLSTETGPPMEAYTKVLDLLTAHIGNN
NT seq 477 nt NT seq  +upstreamnt  +downstreamnt
ttgcacttaaaggtcggcaaccgaaaagctgaagagaaaatgaatattctagtccttcat
ggtcccaatatgaacctcattggcgtccgtgcatcttctataggtgagaacgtcaccctg
gacaaaatcaacacagctctccgacgtgaggcacgtcaaaaaaaggtgacgctaaaaatt
ctccaaactgacaatatttctaaagctatgacctttataaagcgaaaaagaaaatgggca
gatgggtgtctcatttcacccggagcctgggctcggaacggttttgatcttcttgataca
atacaactgtgccagcttcctactgtggaggttcatttcagttcagactacgatccgtcg
aacttcgctgcctcatccatcatttcagattcgtgcctctcaacagagacgggaccaccc
atggaagcttacaccaaagtgctggatctccttacagcacatataggaaacaattaa

KEGG   T31013 (Metagenome): 435731Help
Entry
435731            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22372494_1_gene435731
Definition
strand:+ start:1436 stop:1744 length:309 start_codon:yes
stop_codon:no gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
tmz:Tmz1t_0845 (best score: 157.532)
Taxonomy
Betaproteobacteria [GN:tmz]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 103 aa AA seqDB search
MKILLINGPNLNLLGTREPQIYGATTLADVEAAARAQAQAAGAELAAFQSNHEGAIVDAI
HAARTDGTGYIVINPGAFTHTSVAIRDALAGVAIPFIEVHISN
NT seq 309 nt NT seq  +upstreamnt  +downstreamnt
atgaaaatcctgctcatcaacggccccaacctcaacctgctcggcacccgtgagccgcag
atctacggcgccaccacgctggccgacgtcgaagccgcggcccgtgcccaggcgcaggcc
gcaggcgccgagctggccgccttccagagcaaccacgaaggcgccatcgtcgacgccatc
catgccgcccgtaccgacggcacgggttacatcgtcatcaaccccggcgccttcacccac
accagcgtggccatccgcgatgcgctggccggcgtggcgattccgttcatcgaggtgcac
atcagcaac

KEGG   T31013 (Metagenome): 439559Help
Entry
439559            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22380732_1_gene439559
Definition
strand:+ start:1658 stop:2023 length:366 start_codon:yes
stop_codon:no gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
des:DSOUD_2141 (best score: 145.591)
Taxonomy
Deltaproteobacteria [GN:des]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 122 aa AA seqDB search
MVMDKIVRIAVINGPNLGLLGRREPEVYGTDTLDDVNGAVESLGSELGVEVETFQSNSEG
AILDFLDDASHRVDGFLVNPGGLTHTSVALRDGLVGVGLPFVEVHLSNTIARESFRRHSY
LS
NT seq 366 nt NT seq  +upstreamnt  +downstreamnt
atggtgatggataagatcgtgcgcatcgctgttatcaacggtcccaacctcggtttgctc
ggacgccgggaacccgaggtctacggaaccgacacgttggacgacgtgaacggcgccgtg
gaatcgctgggttccgagttgggcgtggaggtcgagacgttccagtccaactcagaggga
gccattctcgacttcttggacgatgccagccatcgggtcgacggctttctggtaaatcca
ggagggctaactcacacgagcgtggctctacgtgatggtctggtgggtgtagggcttccg
ttcgtggaggtccatctctccaatacgatcgctcgggagagtttccggcgtcattcttat
ctctcg

KEGG   T31013 (Metagenome): 442350Help
Entry
442350            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22386796_1_gene442350
Definition
strand:+ start:1220 stop:1648 length:429 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
tta:Theth_0488 (best score: 68.9366)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 142 aa AA seqDB search
MTILVLQGPNLNLLGLKSSTAEDSLTLDRFNRAIRRHVRNKEIKLKIIQTHKEYIALNFI
QRNRNQAKGLVIIPTSWAKYNQTILETIHLSKLPTASIYFKKSISFGTQENESILLGNNI
KPFTGNPIDATISAIDYIAKIK
NT seq 429 nt NT seq  +upstreamnt  +downstreamnt
atgacaatattagtactacaaggaccaaaccttaatcttctaggtttaaaatcatcaacc
gccgaagattcactaacactagacagatttaaccgagcaattagacggcacgttagaaat
aaagaaatcaaactaaagattatacaaacacataaagaatacatagcgcttaacttcatt
cagaggaacagaaaccaggcaaaagggttagttattattcctacttcttgggcaaagtac
aatcaaaccatactagagactattcacctgtcgaaacttcctacagcatctatttatttt
aaaaaatcaattagcttcggtacacaagaaaatgaatctatccttttgggtaataacatt
aaaccttttactgggaatcctattgatgctacaatatcagcaatagactatattgctaaa
attaaatga

KEGG   T31013 (Metagenome): 443650Help
Entry
443650            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22389450_1_gene443650
Definition
strand:- start:323 stop:757 length:435 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
tta:Theth_0488 (best score: 82.8037)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 144 aa AA seqDB search
MKILVLQGPNLNLLGVKSAQQGERLTLDKLNKALRKHVRNTAVELKILQTHKEYIALNFI
QRNRNQADGLLLIPMSWARYNWTLEETLSLVRLPTAIVYFDDPYDFGTSEKNSILSNVAT
RSITGPPMEACINALDHIIDHSSN
NT seq 435 nt NT seq  +upstreamnt  +downstreamnt
atgaaaatattagtgttacagggacccaatcttaatcttcttggggtaaaatcagcacaa
cagggtgaaagattaaccctggacaagctgaataaagcactgagaaaacatgtccgaaat
actgctgttgaactgaagatccttcagacccataaggaatatattgcactgaattttatt
cagcgcaatcgaaaccaggctgatggtcttttgcttattcctatgtcctgggctcggtac
aattggacattagaagaaacactgagccttgtaaggcttccaactgcaattgtttatttt
gatgatccttatgattttggcacatctgaaaagaattctatactatcaaatgttgcaaca
agatcaattacgggaccacctatggaggcctgtataaatgctctggaccatattatagat
cattcctcaaattga

KEGG   T31013 (Metagenome): 444606Help
Entry
444606            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22391482_1_gene444606
Definition
strand:- start:1852 stop:2328 length:477 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
for:FORMB_01050 (best score: 208.379)
Taxonomy
Bacteroidetes [GN:for]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 158 aa AA seqDB search
MVNYIALIKCYFYIFIKNILMKLQIINGPNLNLLGIREKSIYGDQNFDEYFNDLKIKYTK
LDLHYFQSNIEGELIEKIQEVGFEFDGIIINAAAYTHTSVGIGDAIKSVNSPVIEVHISN
TYTREEFRHKSFLSAHVRGVILGFGLKSYDLAIESFLD
NT seq 477 nt NT seq  +upstreamnt  +downstreamnt
atggttaattatatagcattaattaaatgttatttttatatttttataaaaaatatttta
atgaaattacaaattataaatggtcctaatctaaatttattagggataagagaaaaaagt
atttatggcgatcaaaattttgatgaatattttaatgatttaaaaataaaatacacaaaa
ttagatcttcattattttcaatctaatattgaaggagagttaattgaaaaaattcaagaa
gttggttttgaatttgatgggattatcattaatgctgctgcttatactcatacttcagtt
ggtattggcgatgcaattaaatcagtaaatagtccagtaatagaggtgcatatttccaat
acatatacaagagaagaatttagacataaatcttttttaagtgctcatgtaaggggtgtt
attttagggtttggcctaaaaagttatgatttagctatagaaagttttttggattaa

KEGG   T31013 (Metagenome): 445493Help
Entry
445493            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22393296_1_gene445493
Definition
strand:+ start:2115 stop:2555 length:441 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
maq:Maqu_3443 (best score: 281.952)
Taxonomy
Gammaproteobacteria - Others [GN:maq]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 146 aa AA seqDB search
MSTILVLHGPNLNMLGTREPEVYGYETLADIDDRLRSLAAEHGHHLLHLQSNAEYELIER
VHEARAEGVDFIIINPAAFTHTSVALRDAMLASGIPFIEVHLSNVHAREPFRHHSYFSDI
AEGVICGLGSQGYDLALQAALKRIHR
NT seq 441 nt NT seq  +upstreamnt  +downstreamnt
atgtcgacaattctcgtgctccacggacccaacctcaacatgctcggtacccgcgagccg
gaggtctatggttacgagacactggcagacatcgacgaccggttgcgctcactggcagca
gagcatgggcatcatctgctgcacctgcaatcaaatgccgaatacgaactgattgagcgg
gttcacgaggcccgggcggaaggcgtggacttcatcatcatcaaccccgccgccttcacc
cataccagcgttgccctgcgcgacgccatgctggcctcgggaattccatttatagaagtg
catctttcgaacgtgcatgcccgggaaccgttccggcatcactcctatttctcggatatc
gccgaaggcgttatctgtgggctgggtagccaggggtacgacctcgcactccaggcagcc
ctgaaacgcattcaccgatag

KEGG   T31013 (Metagenome): 446701Help
Entry
446701            CDS       T31013                                 

Gene name
133_MES_0d2-3_C22395858_1_gene446701
Definition
strand:- start:3377 stop:3646 length:270 start_codon:no
stop_codon:yes gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
hor:Hore_06130 (best score: 75.8701)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 89 aa AA seqDB search
QDNTKDAHAIIINPGGLTTVGFPLLDALIDSGKLSIEVHISDIHKREEFRRNSIFPNYCV
SQISGMGIEGYVQALSDICKYPTEKNNGI
NT seq 270 nt NT seq  +upstreamnt  +downstreamnt
caagataatactaaagatgctcacgcaattattataaatcctggaggccttacaactgtt
ggcttccctcttttggatgctcttattgactcaggtaaattatcaatagaagttcatatt
tctgatattcataaaagagaggaatttagaagaaattcaatttttccaaattattgcgtc
tcgcaaatttctggaatggggattgaaggttacgttcaggcactttcagatatttgcaaa
tatcctactgaaaagaataatggaatataa

KEGG   T31013 (Metagenome): 45874Help
Entry
45874             CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold59589_1_gene45874
Definition
strand:- start:1061 stop:1492 length:432 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
pbf:CFX0092_A1951 (best score: 164.466)
Taxonomy
Chloroflexi [GN:pbf]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 143 aa AA seqDB search
MNILVINGPNLNLLGTREPEIYGPETLEELMMWLETSQQGSNHSFKFFQSNHEGEIIDTI
HDERHWAAGILINPAAFTHYSYAIRDAISAVEIPAIEVHLSDIQNREEFRQISVISPVCV
DQVSGMGKDSYLKGLKLLLKHDA
NT seq 432 nt NT seq  +upstreamnt  +downstreamnt
atgaacattttagtaatcaatggaccaaacctgaatctgttgggaacacgtgaaccagaa
atttatggtcctgaaacattggaggagctgatgatgtggttggaaaccagccaacagggt
tcgaaccattctttcaaattttttcaatcaaatcatgagggggagattattgataccatt
catgatgaacggcattgggcggcggggatattgataaatcctgctgcatttacccattat
tcctatgcaattcgggatgctatttcagccgtggagattcccgccattgaagtgcatctc
agtgatattcaaaatcgtgaggaatttagacagatttctgtcatatctccggtatgtgtc
gatcaggtttccgggatggggaaggacagttatttaaaaggattaaaactgcttcttaaa
catgatgcttag

KEGG   T31013 (Metagenome): 5007Help
Entry
5007              CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold6557_2_gene5007
Definition
strand:+ start:1172 stop:1624 length:453 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
abai:IMCC26256_111019 (best score: 174.481)
Taxonomy
Actinobacteria [GN:abai]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 150 aa AA seqDB search
MWTMSDQLLLLLSGPNLNLLGERQPDVYGTETLDDHVESARLAAGARGLTLEHVQSNHEG
ELVDAIHAARGRCAGIVVNPGAFTHYAWAIHDALAAFEGPVVELHLSNPAAREPWRHTSV
VAPVASGTIAGFGGAGYRMAVEAVADLLDG
NT seq 453 nt NT seq  +upstreamnt  +downstreamnt
atgtggaccatgagtgatcaactgctgctgctcctctcgggtccgaacctgaacctgctg
ggggagcgccagccggacgtctacggcacggagaccctggacgaccacgtggagtccgcc
cggctcgcagccggtgccaggggcctgacgctggagcacgtccagtccaaccacgagggc
gagctggtggacgccatccacgcggcgcgtggtcgatgtgcgggcatcgtcgtgaacccc
ggggcattcacccactacgcgtgggccatacatgacgccctggcggcattcgagggtccg
gtggtggagctgcacctctccaacccggcggcccgcgaaccgtggcgccacacctcggtg
gtggcgccggtggcctccgggaccattgccggtttcggtggggccggctaccggatggcg
gtcgaggccgtcgccgacctcctggacggatga

KEGG   T31013 (Metagenome): 51051Help
Entry
51051             CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold65204_1_gene51051
Definition
strand:- start:3 stop:320 length:318 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
pub:SAR11_0728 (best score: 171.4)
Taxonomy
Alphaproteobacteria [GN:pub]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 106 aa AA seqDB search
MNNIIIINGPNINLLGEREQSQYGSITFDQLKKICLEKAKELNINLNFTQSNIEGEIVTI
IQQARDKYDGIIINAAGFSHTSVAIRDALNIFKKPSIELHISNIYK
NT seq 318 nt NT seq  +upstreamnt  +downstreamnt
atgaataatattattattattaatggtccaaatattaatctattaggcgaaagagaacaa
tcacaatatggatcaataacttttgatcaactaaagaagatttgtttagaaaaagcaaaa
gaattaaatattaacttgaattttactcaatcaaacatagaaggtgaaattgtcacaatc
atccagcaagctagagataaatatgatggtataataattaatgctgcaggtttttctcat
acatcagttgctataagagatgccttaaatatatttaaaaaacccagtatcgaactacac
atatcaaacatatataaa

KEGG   T31013 (Metagenome): 62937Help
Entry
62937             CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold79412_1_gene62937
Definition
strand:- start:33 stop:479 length:447 start_codon:yes stop_codon:yes
gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
rsb:RS694_05650 (best score: 253.062)
Taxonomy
Betaproteobacteria [GN:rsb]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 148 aa AA seqDB search
MNILVLHGPNLNLFGRREPHIYGTTTLAEINERLGAIARELDVTLETFQSNHEGALIDKL
HERIDSAQGALVNPAGLTQHGVPLHDAIKAMPFPVLEIHMSNIAAREAWRAHSIISPAVK
ATIQGLGWRSYTFGLRALVDLVRDNRQA
NT seq 447 nt NT seq  +upstreamnt  +downstreamnt
atgaacatcctcgtcctgcacggccccaacctcaacctgttcggccgccgtgagccgcac
atctacggcaccaccacgctggccgagatcaacgaacgcctgggcgccatcgcccgtgag
ctggacgtgacgctcgagaccttccagagcaaccacgaaggcgcgttgatcgacaagctg
catgagcgcatcgacagcgcccagggcgcgctggtgaacccggccggcctgacgcagcat
ggcgtgccgctgcacgacgcgatcaaggccatgccctttccggtgctggagatccacatg
tccaacatcgcggcgcgcgaggcctggcgggcgcactccatcatctcgccggcggtcaag
gccaccatccagggcctgggctggcgctcttacaccttcggcctgcgggcgctggtggac
ctggtgcgcgacaaccgccaggcctga

KEGG   T31013 (Metagenome): 63348Help
Entry
63348             CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold79987_1_gene63348
Definition
strand:- start:482 stop:922 length:441 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
maq:Maqu_3443 (best score: 295.049)
Taxonomy
Gammaproteobacteria - Others [GN:maq]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 146 aa AA seqDB search
MSTILVLHGPNLNMLGTREPEVYGHETLADIDDRLRSKAAEKGHHLLHLQSNAEYELIER
VHEARAEGVDFIIINPAAFTHTSVALRDAMLASGIPFIEVHLSNVHAREPFRHHSYFSDI
AEGVICGLGSQGYDLALKAALQRIHR
NT seq 441 nt NT seq  +upstreamnt  +downstreamnt
atgtcgaccattcttgtgctccacggcccgaacctgaatatgctcggaacccgagagccc
gaggtctatggccacgaaaccctggccgatatagacgaccgcttgcgcagcaaggcggct
gagaaaggccatcatctgttacacctgcagtcaaacgcggaatatgaattgatagaaaga
gtgcatgaagccagggctgaaggggtggatttcatcatcatcaatcccgccgccttcacc
cacaccagcgtggcccttcgggatgccatgctggcgtcgggcattccctttatcgaagtg
catctttcaaacgtgcatgcgcgggaacctttccgccatcactcttatttttcagatatc
gccgaaggcgttatctgcgggctgggcagccagggctacgatctcgccctgaaggcggcc
ctgcaacgaattcaccgatag

KEGG   T31013 (Metagenome): 7076Help
Entry
7076              CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold9457_1_gene7076
Definition
strand:+ start:76 stop:534 length:459 start_codon:yes stop_codon:yes
gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
hin:HI0970 (best score: 162.54)
Taxonomy
Gammaproteobacteria - Others [GN:hin]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 152 aa AA seqDB search
MPTVLLLNGPNLNLLGTREPEIYGSTTLTEIEEQVSASLRERNIECETFQSNSEGEIIDW
LHLHREADFLLLNPGALTHTSVGLRDAVLGVEIPFLEIHLSNVHQREEFRHCSYFSDIAV
GALVGLGVKGYLLATQFAADFLEQKGTSAANN
NT seq 459 nt NT seq  +upstreamnt  +downstreamnt
atgcctaccgtacttttgctaaatggcccaaatcttaatttgctggggactcgtgaacca
gaaatttacggttcaacgaccttgacggaaatcgaagaacaagtttcggcttcacttcgt
gaacgcaacattgagtgtgagaccttccagtcaaattctgaaggagaaattattgactgg
ctgcatttacatcgggaggcagattttttacttttgaatccaggggcattgactcatacc
agtgttggtctgcgggatgcagtgctgggcgtagaaataccttttctggaaatccacctt
tccaatgttcatcagcgtgaagagtttcgacattgttcctatttttcagatattgcggtt
ggggcactagtaggtcttggagtcaaaggttatttactggcaacgcagtttgcagcagat
tttctcgagcaaaaaggaacatctgcagccaacaactga

KEGG   T31013 (Metagenome): 72400Help
Entry
72400             CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold91014_1_gene72400
Definition
strand:+ start:201 stop:629 length:429 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
tta:Theth_0488 (best score: 80.1073)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 142 aa AA seqDB search
MNILILQGPNLNLLGLKSALTGDRLTLDKLNKALRKHVHRQETTLKFLQTHKQDKALNFL
QRNRNWADGLLFIPTSWARYDWTMTETLELIALSTAVVHFEEPYDYGTSVSDSIISGKNI
KSFSGLPVESCIEGLDYLLSLK
NT seq 429 nt NT seq  +upstreamnt  +downstreamnt
atgaatattctcattttacagggacctaatttgaacctcctgggtttgaaatctgcgctg
acaggagacaggctgaccctggataaattaaataaagctttaagaaaacacgtgcacaga
caggaaacaaccttaaaatttctgcaaactcataaacaggataaagcgctgaacttcctg
cagcgcaaccgcaactgggctgatggattgcttttcattcccacatcatgggcccgatac
gactggaccatgacggaaaccctggaattgatcgccctctccacagcagtggtgcatttt
gaagaaccttatgattacggaacctctgtatcagattctatcatttcgggaaaaaatatc
aaatcattttccgggctacctgttgaatcttgcattgagggcctggattatcttttatcc
ctcaaataa

KEGG   T31013 (Metagenome): 74547Help
Entry
74547             CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold93685_1_gene74547
Definition
strand:+ start:1305 stop:1391 length:87 start_codon:yes
stop_codon:no gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
psub:Pelsub_P1225 lep:Lepto7376_2679 (best score: 53.1434)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 29 aa AA seqDB search
MKILVIHGPNLNLLGIREPDIYGSITMEQ
NT seq 87 nt NT seq  +upstreamnt  +downstreamnt
atgaaaatattagtaattcatggtccgaacctcaaccttcttggtattagagaacctgat
atctatggctctataaccatggaacaa

KEGG   T31013 (Metagenome): 76422Help
Entry
76422             CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold96096_1_gene76422
Definition
strand:+ start:841 stop:1275 length:435 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
nao:Y958_14040 (best score: 198.364)
Taxonomy
Alphaproteobacteria [GN:nao]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 144 aa AA seqDB search
MKNAVIIINGPNLNMLGEREPDVYGSETLADIEQTCLACAKSLGLKLDFRQSNSEGEIVE
WVQESSKLFTAIIINAGAYTHTSIAIHDALKGSGLPIFEVHLSNIFQREDFRHVSYIANV
AKGVICGFGSQGYEFALNATAKYL
NT seq 435 nt NT seq  +upstreamnt  +downstreamnt
atgaaaaacgccgtgatcatcattaacgggccaaatcttaatatgttaggggagcgcgag
cccgacgtttatggcagtgaaactttagcagatattgaacaaacctgtcttgcttgtgcc
aaaagtctgggactaaaactcgatttccgccaaagtaacagcgaaggtgaaattgttgaa
tgggttcaagaatcttcaaagttatttaccgcaataattattaacgccggtgcttacaca
cacacttccattgctattcatgatgctttgaaaggtagcggtcttcctatatttgaagtt
catttatccaatatattccaacgggaagattttcgccatgtttcctatattgcaaatgtt
gctaaaggggtaatatgtggttttggaagtcaagggtacgaatttgctctgaatgcaaca
gcaaaatatttgtga

KEGG   T31013 (Metagenome): 80901Help
Entry
80901             CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold100982_1_gene80901
Definition
strand:+ start:466 stop:600 length:135 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
chy:CHY_1874 (best score: 55.4546)
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 45 aa AA seqDB search
MSNFLLLNGPNLNLLGKRETEIYGKVSLKEIENDLSKLAKKKGHE
NT seq 135 nt NT seq  +upstreamnt  +downstreamnt
atgtcaaattttcttcttttaaatggaccaaatcttaatctcttaggaaaaagagaaacg
gagatatatggaaaagtaagtttaaaagaaatagaaaatgatttatctaagttagccaaa
aaaaaaggtcatgag

KEGG   T31013 (Metagenome): 81542Help
Entry
81542             CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold101689_1_gene81542
Definition
strand:+ start:2307 stop:2741 length:435 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
hml:HmaOT1_11415 (best score: 178.333)
Taxonomy
Alphaproteobacteria [GN:hml]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 144 aa AA seqDB search
MKKKIYILNGPNLNLLGEREPEIYGRSSLKDVEKSLNKIAKTNSLEIVFEQSNHEGELIE
LIQTASKESKGIIINPAGYTHTSIAIYDALLSSKLPIIEVHLSNIYKRENFRHISYVSKA
ADGIISGLGVEGYIFALKALISKI
NT seq 435 nt NT seq  +upstreamnt  +downstreamnt
atgaaaaaaaagatttatatattaaatggacctaatctaaaccttttaggagaaagagaa
ccggaaatatatggaagatcttctcttaaagatgttgaaaaatctctcaataaaattgca
aaaacgaacagcttagaaatagtatttgaacagagcaatcatgagggtgagttaatagag
ttaattcagactgcgtctaaagaaagtaaaggaataattattaatccagcaggatacaca
catacttcgatagcaatttatgatgctttattaagctctaaacttccaattatagaagtt
catttgtctaatatttataaacgtgaaaattttagacatatttcctatgtatcaaaggct
gcggacggtattataagtggtctaggagttgagggatatatttttgcactaaaagcattg
attagtaaaatatag

KEGG   T31013 (Metagenome): 84081Help
Entry
84081             CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold104913_1_gene84081
Definition
strand:- start:278 stop:631 length:354 start_codon:yes
stop_codon:yes gene_type:complete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
abai:IMCC26256_111019 (best score: 121.324)
Taxonomy
Actinobacteria [GN:abai]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 117 aa AA seqDB search
VAAARHRAQQRGFDLEHIQSNHEGDLIDAIHTARNRATSIVINPGALTHYSWALHDALAA
YEGPIVELHISDPKQREPWRHTSVVEPLAVKTVAGKGAAGYPEAVDIAIDASLTHDS
NT seq 354 nt NT seq  +upstreamnt  +downstreamnt
gtggctgccgctcgccaccgtgctcagcaaaggggatttgatctagagcacatacagagc
aaccacgagggtgacctgattgatgccatccataccgcccgcaatcgcgccacctccatc
gtgattaatcctggcgccctcactcactattcgtgggcattgcatgacgcccttgccgcc
tacgaaggcccaatcgtcgaacttcatatttccgaccccaaacagcgagagccatggcga
catacttcagtggtcgagcccttagcagtgaaaacagttgcaggtaagggagctgcgggc
tatcccgaggccgttgacatagcgattgacgcttcactgactcatgattcgtga

KEGG   T31013 (Metagenome): 84550Help
Entry
84550             CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold105478_1_gene84550
Definition
strand:+ start:114 stop:509 length:396 start_codon:yes stop_codon:no
gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
tpro:Ga0080559_TMP4094 (best score: 152.14)
Taxonomy
Alphaproteobacteria [GN:tpro]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 132 aa AA seqDB search
MIIRADMKVLFLNGPNLNLLGQREPEIYGSMKLSDIEDMVREHGERHGVEVVFHQSNHEG
ELVTQVQQSAGDYDYVILNAAAYTHTSIGLKDAIVGAGVKAIEIHLTNVHARESYRQTSI
IAQACIGSINGF
NT seq 396 nt NT seq  +upstreamnt  +downstreamnt
atgataatccgcgcggacatgaaggtactgttcctcaacggccccaacctaaacctgctg
ggccaacgcgaaccggagatttacggcagcatgaagctgtcggacattgaggatatggtt
cgtgaacatggcgagcggcatggcgtcgaggtggtgtttcaccaatccaaccacgagggc
gaactggtgacgcaggtgcagcagtcggccggcgactacgactacgtgatcctcaacgcg
gcggcgtacacgcacacgagcatcgggctcaaggacgccatcgtcggcgcgggcgtgaaa
gcgatcgagatacaccttaccaacgtccacgcccgcgagtcgtaccggcaaacatcgatc
atcgcccaggcctgcatcggcagcattaacggcttc

KEGG   T31013 (Metagenome): 95309Help
Entry
95309             CDS       T31013                                 

Gene name
133_MES_0d2-3_scaffold118996_1_gene95309
Definition
strand:+ start:1039 stop:1422 length:384 start_codon:yes
stop_codon:no gene_type:incomplete
  KO
K03786  3-dehydroquinate dehydratase II [EC:4.2.1.10]
Best hit
pub:SAR11_0728 (best score: 196.052)
Taxonomy
Alphaproteobacteria [GN:pub]Taxonomy
Pathway
00400  Phenylalanine, tyrosine and tryptophan biosynthesis
01100  Metabolic pathways
01110  Biosynthesis of secondary metabolites
01130  Biosynthesis of antibiotics
01230  Biosynthesis of amino acids
LinkDB All DBs
AA seq 128 aa AA seqDB search
MKNNIIVINGPNLNLLGEREQSQYGSIKYEDLKNECLKYSKGLEINIDFTQSNIEGEIVT
LIQDARKKYDGLIINAAGFTHTSIAIRDALVIFKKPSIELHISNIYKREKFRHKSMISSV
VTGVICGL
NT seq 384 nt NT seq  +upstreamnt  +downstreamnt
atgaaaaataatattattgttattaatggtccaaatcttaatctattaggggaaagagaa
caatcacaatatggctctatcaaatatgaagatttaaaaaatgaatgtctaaaatattcc
aaaggcttggaaatcaatattgattttactcaatctaatattgaaggcgaaattgtaaca
ctaatacaggatgcaagaaaaaaatatgatggtttaataattaatgctgctgggttcacc
catacctcaattgctattcgtgatgcattagtaatttttaaaaaacctagtattgaactt
cacatatcaaatatctacaaaagagagaaatttagacataaatctatgataagtagcgta
gtaactggggtaatttgtggattg

DBGET integrated database retrieval system