KEGG   T31050 (Metagenome): 329Help
Entry
329               CDS       T31050                                 

Definition
OSD10_2014-06-21_1m_NPL022_spades_contig-385_+_1_468_orf-1
  KO
K10747  DNA ligase 1 [EC:6.5.1.1 6.5.1.6 6.5.1.7]
Best hit
pmm:PMM1679 (best score: 184.496)
Taxonomy
Cyanobacteria [GN:pmm]Taxonomy
Pathway
03030  DNA replication
03410  Base excision repair
03420  Nucleotide excision repair
03430  Mismatch repair
LinkDB All DBs
AA seq 155 aa AA seqDB search
VTCLANELVDLDTDAGQLRYKEINAQAVTGGYEGIMIKDPEAGYECKRSVAWLKLKPFIE
VSLEVVDVEEGTGRNVSRLGAIVCQGVDDGKAIRVNVGSGFSDSDRDIFWTSRDSLLGQI
VEVRADAVTQNQDGTYSLRFPRFLRFRGFQVGEKL
NT seq 468 nt NT seq  +upstreamnt  +downstreamnt
gttacttgccttgccaatgaactagttgatttggatacagatgcaggtcagttgcgctac
aaagaaattaacgcacaggcagttactggtgggtatgaaggtattatgattaaagatcca
gaagctggatacgaatgtaaacgaagtgtagcgtggctaaaacttaaaccattcattgaa
gtatcattggaggtagtagatgttgaagaaggcacgggacgaaacgttagcaggcttgga
gcgattgtctgccaaggagtcgatgacggcaaagctattcgggtcaatgttggcagtggt
tttagcgatagtgatcgcgatattttttggacttcacgcgattccctacttggtcagatc
gtggaagtgcgagcagatgccgtcacccaaaaccaagacggaacatacagtctgcgattt
ccaaggttcctacggttccgtggattccaagtaggagagaagctttga

KEGG   T31050 (Metagenome): 424Help
Entry
424               CDS       T31050                                 

Definition
OSD10_2014-06-21_1m_NPL022_spades_contig-529_-_2_568_orf-1
  KO
K10747  DNA ligase 1 [EC:6.5.1.1 6.5.1.6 6.5.1.7]
Best hit
pmm:PMM1679 (best score: 161.384)
Taxonomy
Cyanobacteria [GN:pmm]Taxonomy
Pathway
03030  DNA replication
03410  Base excision repair
03420  Nucleotide excision repair
03430  Mismatch repair
LinkDB All DBs
AA seq 189 aa AA seqDB search
DSVFNIFDIIPLSDFREGHWNAQLRKRIAILEHIRHVVDTMPNVELLPHIMVDLDTAAGK
DQLERYAKDNVNAGFEGIMIKELEAPYQCKRSTDWMKWKPTITVDLEVVGVEEGTGRNLG
RLGALVCAGVDDGKEISVNVGSGFSDTDRDDYWGNRNLVIGRTAEVLCDVITQNQDGTYS
LRFPRFVRF
NT seq 567 nt NT seq  +upstreamnt  +downstreamnt
gatagtgtattcaatatctttgacattattccattaagtgatttccgtgaaggacattgg
aatgctcaactacgtaaacgtattgctatacttgaacacattcgccacgtagttgacact
atgcctaacgttgaactcttgccacatatcatggttgacttagatacagccgcaggtaag
gatcaacttgaacgttatgctaaagacaatgtgaacgcagggttcgaaggcattatgatt
aaagaattagaagccccatatcagtgcaaacgtagtactgattggatgaagtggaaacct
actattacagtagatttagaagtcgtaggtgttgaagaaggtactggacgtaatcttgga
cgcttgggagcacttgtttgtgcaggtgtagatgatgggaaagaaatttcagtcaatgtc
ggtagtgggttttctgatactgaccgagacgattattgggggaatcgtaatctggtcatt
ggccgcactgctgaggtcttgtgcgatgtgattacacagaaccaagatggtacttacagt
ttgcgtttccctcgctttgttcgtttt

KEGG   T31050 (Metagenome): 813Help
Entry
813               CDS       T31050                                 

Definition
OSD10_2014-06-21_1m_NPL022_spades_contig-1041_-_279_623_orf-2
  KO
K10747  DNA ligase 1 [EC:6.5.1.1 6.5.1.6 6.5.1.7]
Best hit
vg:22276754 (best score: 102.834)
Taxonomy
Viruses [GN:vg]
Pathway
03030  DNA replication
03410  Base excision repair
03420  Nucleotide excision repair
03430  Mismatch repair
LinkDB All DBs
AA seq 114 aa AA seqDB search
GFEGQMLRMNSKYENKRSKSLLKHKSFVDEEYTILDIVEGEGNRTGTAGYMVFETVDGKP
FKSNVKGTWEETAEMLKSKKKLIGKQATIKYFNLTPDGIPRFPFVINIDRNSYE
NT seq 345 nt NT seq  +upstreamnt  +downstreamnt
ggatttgaaggccagatgttacgaatgaatagtaagtatgaaaataagagaagtaaatcc
ttattgaaacataaatcatttgtggacgaagaatatactattttggatatcgtagaaggt
gagggtaaccgtaccggaactgctggttatatggtatttgaaacagtagatggcaaaccg
ttcaaatcaaatgtgaaagggacttgggaagaaactgctgaaatgttaaagagtaaaaag
aaactaataggtaaacaggcaacgattaagtatttcaacttaacgccggatgggatacct
cgttttccttttgtaattaatattgataggaattcgtatgagtaa

KEGG   T31050 (Metagenome): 3536Help
Entry
3536              CDS       T31050                                 

Definition
OSD10_2014-06-21_1m_NPL022_spades_contig-4611_-_989_1621_orf-2
  KO
K10747  DNA ligase 1 [EC:6.5.1.1 6.5.1.6 6.5.1.7]
Best hit
vbh:CMV30_01755 (best score: 146.747)
Taxonomy
Verrucomicrobia [GN:vbh]Taxonomy
Pathway
03030  DNA replication
03410  Base excision repair
03420  Nucleotide excision repair
03430  Mismatch repair
LinkDB All DBs
AA seq 210 aa AA seqDB search
LHERHVALTALGITDQCGGVIRVAPQRVVDGIEEIEAEFIAARMRGSEGIVLKSTTAAYA
PGRRGSAWLKLKHPIDSVDCVVVGVEYGVGRRRTLLSELTFAVRDDLSGRLTTLGRASAQ
LGEREMSEMGRWFETHTVAQLGNYRSVEPRIVVEVSFDELRRSERSGSGYTLRGPRIVRF
RTDLGPDQVASLSAIEARCRAASGSTGETE
NT seq 633 nt NT seq  +upstreamnt  +downstreamnt
ctgcacgagcgacacgttgcactcacggcccttggtatcacggaccagtgcggcggcgtc
attcgagtagcgccgcagcgcgtcgtcgacggcattgaagagattgaggcagagttcatt
gccgcgcgcatgcgcggctccgagggaatcgtgttgaagtcgacgaccgctgcctacgcc
ccaggtcgtcgcggttcagcgtggctcaagttgaagcatccgattgatagcgtcgactgc
gtggtcgttggtgtggagtacggcgttgggcgtcgccgaacactcttgtcagagttgact
tttgccgtgcgcgacgatctctctggccggctcacaacgctcggacgtgcctccgcacaa
cttggtgagcgcgagatgagcgagatgggacgctggtttgagacacacactgttgcgcag
ctcggcaactatcgcagcgttgagccacgcatcgtggttgaagtgtcgtttgatgagctg
cgacgaagtgagcgcagcggctcgggctacacactgcgtggaccgcgcatcgtgcgattc
cgcaccgaccttggccctgatcaggtagcgtcactctcagcgattgaggcgcgctgccgc
gcggcaagcggatcaacaggggagacagaatga

KEGG   T31050 (Metagenome): 10415Help
Entry
10415             CDS       T31050                                 

Definition
OSD10_2014-06-21_1m_NPL022_spades_contig-13305_-_712_1407_orf-2
  KO
K10747  DNA ligase 1 [EC:6.5.1.1 6.5.1.6 6.5.1.7]
Best hit
vg:26637057 (best score: 191.43)
Taxonomy
Viruses [GN:vg]
Pathway
03030  DNA replication
03410  Base excision repair
03420  Nucleotide excision repair
03430  Mismatch repair
LinkDB All DBs
AA seq 231 aa AA seqDB search
MSKGFKPLLAATLTQDEIEKLPYPMYLSAKLDGIRAVIRDGVVYSRNLKRIPNEYVQLLF
GQAKYNGFDGELIVGKSNAENVYNVTVSGVMSEDGEPDVRFWVFDDADETNSDMPYRLRL
QNVQRRLVNAVPADRVHVMPQNVVDNEHTLLSFEKALVEDGYEGVMVRSMNGKYKHGRAT
NREANIFKLKRFSDSEAEILGFEELYKNMNDKQVNELGNSFRSRRCVTRHA
NT seq 696 nt NT seq  +upstreamnt  +downstreamnt
atgtctaaaggtttcaagcctttgctcgctgcgactctaactcaagacgagatagagaag
cttccgtatccgatgtatctatctgcgaaacttgacggcatccgtgccgtcattcgcgat
ggtgtcgtctactctcgcaatctgaaacgtattcctaatgagtacgttcagcttctgttc
ggtcaagccaagtataatggctttgacggcgaactgattgttggcaagagtaatgctgag
aatgtttacaacgtcactgtctctggtgtaatgagcgaggacggcgaacctgatgtgcgc
ttctgggtgtttgacgatgccgatgaaacaaattctgatatgccatatcgcttacgtctt
cagaatgttcagagacgtctggtgaatgctgtgcctgctgaccgagtccatgtcatgcca
caaaacgtggttgacaacgagcatacgttgctctcgttcgagaaagcgttggtcgaagat
ggctacgagggtgtaatggttcgtagcatgaacggcaaatataagcatggtcgcgccact
aatcgtgaagccaacatctttaagctgaagcgattcagtgacagcgaagctgagatcctt
ggcttcgaagaactttacaagaacatgaatgacaagcaagtgaacgaactgggtaacagc
ttccgttctagacgttgcgtaacccgacatgcgtaa

KEGG   T31050 (Metagenome): 10505Help
Entry
10505             CDS       T31050                                 

Definition
OSD10_2014-06-21_1m_NPL022_spades_contig-13419_-_29_577_orf-1
  KO
K10747  DNA ligase 1 [EC:6.5.1.1 6.5.1.6 6.5.1.7]
Best hit
vg:26101458 (best score: 132.109)
Taxonomy
Viruses [GN:vg]
Pathway
03030  DNA replication
03410  Base excision repair
03420  Nucleotide excision repair
03430  Mismatch repair
LinkDB All DBs
AA seq 182 aa AA seqDB search
YDAFTKGICSVPYNQRLESLCVMADTYQPKKVALVDRWEVDTMEEVNTIFNGLLEQGEEG
IILKTHDGIWEDKRAKHQIKFKGELECDLKIVAVEEGKGKAVGMLGAIVCESSDGVVQVS
VGSGFSDAQRKQFWKENIVGKVAAIKYNMRIKNKQGEESLFLPIVLEIREDKEVADHSKD
IK
NT seq 549 nt NT seq  +upstreamnt  +downstreamnt
tacgatgcgtttactaaaggtatttgttctgttccatataatcagcgtcttgaatctctt
tgcgtaatggctgacacatatcaacccaagaaagttgcattggtagatcgttgggaagtt
gatactatggaagaagttaatactatattcaatggcttgcttgagcaaggtgaagaaggt
attattcttaagactcatgacggtatctgggaagacaaacgtgcaaagcaccagattaaa
ttcaaaggtgagttggaatgtgatcttaagattgttgctgtcgaagaaggtaaaggtaaa
gcagttggtatgcttggtgccattgtctgcgaatcttcagacggtgttgttcaggttagc
gttggttcgggtttctctgatgcacaacgtaaacagttttggaaagaaaacattgtaggc
aaggttgctgctattaagtacaacatgcgtatcaagaacaagcaaggcgaggaatcgttg
ttccttcctattgtgttggagatccgtgaagacaaagaagtggctgaccatagcaaggat
atcaaatga

KEGG   T31050 (Metagenome): 26705Help
Entry
26705             CDS       T31050                                 

Definition
OSD10_2014-06-21_1m_NPL022_spades_contig-33562_+_1_366_orf-1
  KO
K10747  DNA ligase 1 [EC:6.5.1.1 6.5.1.6 6.5.1.7]
Best hit
pmm:PMM1679 (best score: 152.91)
Taxonomy
Cyanobacteria [GN:pmm]Taxonomy
Pathway
03030  DNA replication
03410  Base excision repair
03420  Nucleotide excision repair
03430  Mismatch repair
LinkDB All DBs
AA seq 121 aa AA seqDB search
IMLKDPDAGYKCKRSVAWLKLKPFIEVSLTVTAVEEGTGRNVGKLGAVVCEGVDDGREIS
VNVGSGFTDSNRDDYWASREAVVGKIVEVRADAITQNQDGTYSLRFPRFLHFRGFANGEK
I
NT seq 366 nt NT seq  +upstreamnt  +downstreamnt
atcatgttgaaagacccggatgccggttataaatgcaagcgatcagttgcttggctcaag
ctcaagccgtttattgaagtatcgctaaccgttacggctgtagaagaaggcacaggtcgt
aatgttggtaagctaggtgccgttgtttgtgaaggggtcgatgatggtagagagatatcc
gttaatgttggtagcgggtttactgatagcaatcgtgatgactactgggctagtcgtgaa
gctgtggttggcaagattgtcgaagtccgagccgatgcaattacacaaaatcaagatggc
acttactctttacgttttccacgatttctccattttagaggctttgcaaatggcgaaaaa
atttga

KEGG   T31050 (Metagenome): 37896Help
Entry
37896             CDS       T31050                                 

Definition
OSD10_2014-06-21_1m_NPL022_spades_contig-47606_+_1241_3049_orf-4
  KO
K10747  DNA ligase 1 [EC:6.5.1.1 6.5.1.6 6.5.1.7]
Best hit
aca:ACP_2652 (best score: 297.36)
Taxonomy
Acidobacteria [GN:aca]Taxonomy
Pathway
03030  DNA replication
03410  Base excision repair
03420  Nucleotide excision repair
03430  Mismatch repair
LinkDB All DBs
AA seq 603 aa AA seqDB search
MNRWASVAQRIESATRTSEKVHLLAAALQRADEVDLEIAVRLMGSRGVVPSGTLSWGTIA
RAAEEVAGAPSGSLAKLLDDGGDLGRAVEDLFESERPLAGPALEEVERSAQTRTEALADA
TGTHPSAHASAAPKLRALPEAFQAIAASSGQRRHDLLVQLFYGCSPVAAKFLVRALIGDL
RIGLRDGLLEAAIAAAFDADLAAVRWAMLLEGDPGRVALLARSGRLDEARLQLFHPIPPM
LAAATSGVPEVVERLSERPEFAGRPEFAVAVEDKYDGVRAQLHVDGERAALYGRDLHDVT
VSFPEITAAARAAGISGIFDGEIVAWEDGRPLPSSTLTSRLTGGAQTLSAQQRTLALFIA
FDCLARSGEPLIQQPYHERRRALEELGLEQISDGQIRIATRVQAEGAEAIETAFIHARQR
GCEGLVVKAPDAPYAPGRRGSGWLKVKRSLDTIDVIIVGAEPGLGRRRALLSECTFAVRD
DLSGRLATIGRATVSLPDAEVASLSQWLEAHTIAQLGSYRSVEPRLVAEVAFDAVRRSER
TASGFALRSPRITRLRSDLGPDQAATLASLESRCHLGSAQPDAWTEREEHEMTDQISHEA
LLQ
NT seq 1809 nt NT seq  +upstreamnt  +downstreamnt
atgaatcgctgggcgagcgttgcgcagcgcattgagagcgcgactcgaacctccgagaag
gtgcaccttcttgccgccgcactgcagcgcgcagacgaggttgaccttgagattgcggtg
cgtctcatgggcagccgcggcgtggtgccgagcggcacactctcgtggggaacgattgcg
cgcgcagccgaggaggttgctggcgcaccatcaggctcgctcgcaaagttgcttgacgac
ggtggagatcttgggcgcgcggtggaggacctctttgagtccgagcgtccactcgctggc
ccggcccttgaagaggtggagcgaagcgcgcagacgcgcaccgaagcactcgcagatgcg
acgggcacacacccgtcagcacacgcgagtgccgcaccaaagctgcgtgcgctcccagag
gccttccaggcgatcgccgcatcaagtggtcagcgtcgtcacgacctgttggttcagctc
ttctatgggtgttcgccagtcgctgcaaaattcctcgtgcgcgccctcattggcgacttg
cgaatcggtctacgtgacggactccttgaagcggcgattgcggccgcgtttgacgctgat
cttgctgcggtccgctgggcgatgctccttgaaggagacccagggagggtggcgctgctc
gcccgtagcggccgcctggacgaggcacgcctgcagctcttccacccaatcccgccgatg
ctcgccgccgccacctccggcgtccccgaggtcgttgagcgactcagcgagcgccctgag
ttcgcgggccgcccagagttcgcagttgccgttgaggacaagtacgacggtgtccgcgcg
cagctacacgttgatggtgaacgcgccgcactctatggacgtgaccttcacgatgtgacc
gtctcattccctgagatcaccgccgctgcgcgcgccgcgggaatcagcggcatcttcgat
ggagagattgttgcctgggaggatggacgcccgttaccttccagcacgctcacctctcga
ctgaccggcggggcgcagacactttcagcacagcagcgcaccctcgcactcttcattgcg
tttgattgtctggcgcgaagtggtgagccgttaatccagcagccgtatcacgagcgtcgc
cgtgcgcttgaagagctgggactcgagcagatcagcgacggacagattcggatcgcaacc
cgtgtgcaagcggaaggggccgaagcaattgagactgcattcatccacgcgaggcagcgt
gggtgtgagggactcgttgtgaaggcaccagacgcaccgtacgcacccggtcgtcgcgga
tctggatggctcaaggtgaagcgatcactggacaccattgacgtcatcattgttggcgca
gagccagggctcggtcgccgccgcgcgctcctctctgagtgcacgttcgccgtgcgagac
gatctctctggacgactcgcaaccattggtcgtgccaccgtttcgctgccagatgcagag
gtcgcctcactcagtcagtggctcgaggcgcacacgattgcgcaactcggctcgtatcgc
agtgttgagccgcgcttggtggccgaggttgcctttgatgcagtgagaaggagtgaacgc
accgcttcgggcttcgcccttcgctccccacggatcacgcgacttcgttcagacttgggc
ccagaccaggctgcaacactcgcctcactggagagccgctgccatcttggcagcgcacaa
cctgacgcatggaccgagcgagaggagcacgagatgactgatcagatctcgcacgaagcg
cttcttcag

KEGG   T31050 (Metagenome): 49250Help
Entry
49250             CDS       T31050                                 

Definition
OSD10_2014-06-21_1m_NPL022_spades_contig-62020_-_3_1076_orf-1
  KO
K10747  DNA ligase 1 [EC:6.5.1.1 6.5.1.6 6.5.1.7]
Best hit
vg:22276754 (best score: 278.87)
Taxonomy
Viruses [GN:vg]
Pathway
03030  DNA replication
03410  Base excision repair
03420  Nucleotide excision repair
03430  Mismatch repair
LinkDB All DBs
AA seq 358 aa AA seqDB search
MKLDTIYKKTKTGATQEWTIEVVGNKYRTHSGQVGGIITTNEWTIVYGKNEGKANATTDS
EQCMKEAVAKRTKKLESGYFENIKHINKTQYFEPMLASKWEDSKDKISYPIFSQPKLDGI
RCIVTKDGMFSRNGKPIISAPHIIESLSEVFESYPELILDGELYADKFANDFNKIVSLVK
KTKPTDADLKESKKNIQYWIYDIPNNDIQFGDRCDRLHDLFNYNFDEMTKHCVEVETKIC
NSEAEVMELYGEYVDNGFEGQMLRMNSKYEHKRSKSLLKHKSFVDEEYTILDIVEGEGNR
TGTAGYMVFETVDGKPFKSNVKGTWEETAEMLKSKKKLIGKQATIKYFNLTPDGIPRF
NT seq 1074 nt NT seq  +upstreamnt  +downstreamnt
atgaaattagatacaatatacaaaaaaacaaagacaggtgcaacacaagagtggacaatt
gaagtagtgggtaacaaataccgaacacatagtggacaagttggtggtatcataactaca
aacgaatggactattgtgtatggtaagaatgaaggtaaagcaaacgcaactaccgatagt
gaacaatgtatgaaagaggcagttgctaaacgaacaaagaagttagagagtggttacttt
gagaatatcaaacacattaacaaaacacaatactttgaaccaatgttggcgagtaagtgg
gaagatagtaaggataagattagttacccaatattctctcaacctaaattggatggtatt
agatgtatcgtaacaaaagatggtatgtttagtcgtaatggtaaaccaatcatttcagca
ccacatattatagaaagtttaagtgaagtatttgaatcatatcctgaattgatattggat
ggtgagttatatgctgacaagttcgcaaatgactttaataagattgtatcgttagttaag
aaaacaaaaccaactgatgcggacttaaaagaaagtaaaaagaacattcagtattggatt
tatgatataccaaacaatgatattcaatttggtgataggtgtgatagattgcatgattta
ttcaattacaattttgatgagatgacaaaacattgtgttgaagttgaaacgaaaatttgt
aatagtgaagccgaagttatggagttgtatggtgagtatgtggataacggatttgaaggc
cagatgttacgaatgaatagtaagtatgaacataaaagaagtaaatccctattgaaacat
aaatcatttgtggacgaagaatatactattttggatattgtagaaggtgagggtaaccga
accggaactgctggttatatggtatttgaaacagtagatggcaaaccgttcaaatcaaat
gtgaaaggaacttgggaagaaactgctgaaatgttaaagagtaaaaagaaattaataggt
aagcaggcaacgattaagtatttcaacttaacgccggatgggatacctcgtttt

KEGG   T31050 (Metagenome): 50710Help
Entry
50710             CDS       T31050                                 

Definition
OSD10_2014-06-21_1m_NPL022_spades_contig-63825_+_975_1871_orf-4
  KO
K10747  DNA ligase 1 [EC:6.5.1.1 6.5.1.6 6.5.1.7]
Best hit
vg:22276754 (best score: 254.988)
Taxonomy
Viruses [GN:vg]
Pathway
03030  DNA replication
03410  Base excision repair
03420  Nucleotide excision repair
03430  Mismatch repair
LinkDB All DBs
AA seq 299 aa AA seqDB search
MKLKTIYKKTKTGATQEWTIEVVDNKYRTHSGQVGGAITTNEWTVVYGKNTGKANGTTDS
EQAFKEAEAKRTKKLESGYFEDVNNINEQQYFEPMLAAKWEDYKDKIQYPIFSQPKLDGI
RCIVTKDGMFSRNGKAIISAPHIGESLNFLFESNPNLILDGELYADKFANDFNAIVSLVK
KTKPTADDLKESAKNIEYHIYDIPSVNETFDGRLEALNELFQYFPKCVKLVETHIADNVD
EVMELYGEYVDKGFEGQMLRLNGKYENKRSKSLLKHKSFVDEEYTILDIVEGEGNRTGT
NT seq 897 nt NT seq  +upstreamnt  +downstreamnt
atgaagttaaaaacaatttacaaaaaaactaagacaggggcaacccaagagtggacaatc
gaagtagtggataataagtaccgaacccatagtggacaagttgggggtgctatcactaca
aacgaatggactgtagtttatggtaagaatacaggcaaagcaaatggtactactgatagt
gagcaagcattcaaagaagctgaggctaaacgtacaaagaaattagagagtggttacttt
gaggatgtgaataacatcaatgagcaacaatactttgaacctatgttagcagctaagtgg
gaggattacaaagataaaattcagtatcctattttttcacaaccgaagctagatggtatc
cgttgtatcgtaactaaagatggtatgtttagtagaaatggtaaggcaatcatttcagca
ccacacattggagaaagcttaaactttttgtttgaatccaatcctaacttaatactggat
ggtgagttatacgctgataagttcgctaatgatttcaacgctatcgtttcattagttaag
aaaactaaaccaactgcggatgacctaaaagaaagtgctaaaaacattgagtatcacatt
tacgatataccttctgttaatgaaacgtttgatggtagattggaggcactcaatgaatta
tttcagtattttccaaaatgtgtaaagttagttgaaacgcatattgctgataatgtggat
gaagttatggaattgtatggtgaatatgtggataaaggttttgaaggtcagatgttacga
ttgaatggtaagtatgaaaacaaacgtagtaaatccctattgaaacataaatcatttgtg
gacgaagaatatactattttggatattgtagaaggtgagggtaaccgaactggaact

KEGG   T31050 (Metagenome): 52512Help
Entry
52512             CDS       T31050                                 

Definition
OSD10_2014-06-21_1m_NPL022_spades_contig-66138_+_1_294_orf-1
  KO
K10747  DNA ligase 1 [EC:6.5.1.1 6.5.1.6 6.5.1.7]
Best hit
vg:22276754 (best score: 84.3445)
Pathway
03030  DNA replication
03410  Base excision repair
03420  Nucleotide excision repair
03430  Mismatch repair
LinkDB All DBs
AA seq 97 aa AA seqDB search
SKSLLKHKSFVDEEYTILDIVEGEGNRTGTAGYMVFETADGKPFKSNVKGTWEETAEMLK
SKKKLIGKQATIKYFNLTPDGIPRFPFVINIDRNSYE
NT seq 294 nt NT seq  +upstreamnt  +downstreamnt
agtaaatccctattgaaacataaatcatttgtggacgaagaatatactattttggatatt
gtagaaggtgagggtaaccgaactggaactgctgggtatatggtatttgaaacagcagat
ggtaaacctttcaaatcaaatgtaaaagggacatgggaagaaacggctgagatgttaaag
agtaaaaagaaattaataggtaagcaagcaacgattaagtatttcaacttaacgccggat
ggtattcctcgttttccttttgttataaacatagatagaaatagttacgaataa

KEGG   T31050 (Metagenome): 61387Help
Entry
61387             CDS       T31050                                 

Definition
OSD10_2014-06-21_1m_NPL022_spades_contig-76986_+_3_986_orf-1
  KO
K10747  DNA ligase 1 [EC:6.5.1.1 6.5.1.6 6.5.1.7]
Best hit
pmm:PMM1679 (best score: 318.931)
Taxonomy
Cyanobacteria [GN:pmm]Taxonomy
Pathway
03030  DNA replication
03410  Base excision repair
03420  Nucleotide excision repair
03430  Mismatch repair
LinkDB All DBs
AA seq 327 aa AA seqDB search
RRILIKDLRCGVSEKTVNKVKKNAVPVFECMLAHDGANHEKKINGVRLLEPKLDGVRCLT
VVNYEARTVIQYTRNGKVLENFSHITDSLLANIDDIGRSFVLDGEVVSDSFQSLMKQVHR
KDDVKANDARLMLFDIIPLSEFKKGKSVLGQKRRSAMLQAMKPTFEKCGNIDIIPQIEVD
IGSYVGELQFKEFNKQAIKDGFEGIMIKVPDAVYECKRSASWLKMKPFIEVSLTVTAVEE
GTGKNEGRMGAIICEGVDDGKTIAVNVGSGFTDEQRTEFWSDKELLVGQVVEVRADAATR
SQDSESVWSLRFPRFLRFRGFKAGEKL
NT seq 984 nt NT seq  +upstreamnt  +downstreamnt
cgacgcattcttattaaagacttacgttgcggtgtaagtgaaaagaccgtaaataaagta
aagaaaaatgcagttccagtatttgaatgtatgctggcacatgacggagcaaatcatgaa
aagaagattaacggtgtacgactcctcgagccaaagttggacggtgtacgatgcctcacc
gttgtcaactatgaagctcgaaccgttattcaatacacaagaaatggtaaagtgctggaa
aactttagccacattacagatagccttttggctaacatcgatgacattggtagatcgttt
gttctcgacggagaagttgtaagtgatagctttcagtcacttatgaaacaggtccatcgt
aaagacgatgttaaagctaatgacgctcgattaatgctatttgatattatacctttaagt
gaatttaaaaaaggtaaaagtgttctaggacaaaaacgccgaagtgcaatgctacaggca
atgaagcccacatttgaaaaatgcggaaacattgatatcattcctcaaattgaagttgat
attggttcttatgtaggagagcttcaatttaaagaattcaacaagcaggcaattaaagac
ggatttgaaggtattatgattaaagtacctgacgcagtttacgaatgtaaacgtagcgcc
agctggcttaaaatgaaaccatttattgaagtaagtcttactgtaacagcagttgaagaa
ggtaccggtaaaaatgaaggccggatgggtgcaattatttgtgaaggtgtagatgatggc
aaaactatcgctgtcaatgttggatcgggttttactgacgagcaacgtactgagttctgg
tcggataaagaattattggtgggtcaagttgtggaagtccgcgctgatgcggcgactagg
agtcaggatagcgagtctgtgtggtctctacgctttccgcgttttctccgattccgtggc
ttcaaagcaggtgaaaagttataa

KEGG   T31050 (Metagenome): 62367Help
Entry
62367             CDS       T31050                                 

Definition
OSD10_2014-06-21_1m_NPL022_spades_contig-78246_-_123_923_orf-2
  KO
K10747  DNA ligase 1 [EC:6.5.1.1 6.5.1.6 6.5.1.7]
Best hit
pmm:PMM1679 (best score: 230.72)
Taxonomy
Cyanobacteria [GN:pmm]Taxonomy
Pathway
03030  DNA replication
03410  Base excision repair
03420  Nucleotide excision repair
03430  Mismatch repair
LinkDB All DBs
AA seq 266 aa AA seqDB search
LTVVDYESRTVTMYTRNGKELVNFPHIVKAFEDNMDNWGRSYVFDGEVVSTSFQALMKEV
HRKENAQAQDARLMLFDIVPLAEFKAGASVMGQKRRSAFLRENFSKLFADSGCIEIITQR
EFDLDVFTDEIEFKDYNKQAVAEGFEGIMIKDPNGKWEGKRSVAWLKQKPFIEVSLAVIE
TEEGTGRNVGKMGALVCEGTEDGKLIRVNVGSGFTDKDRDEFWQCKVDGQVIEVRADAIT
QNQDGTYSLRFPRFMRFRGFKAGEKI
NT seq 801 nt NT seq  +upstreamnt  +downstreamnt
ctaactgtggtagactacgaaagccgcacagttaccatgtacactcgcaatggcaaagaa
ttggttaactttccacatatcgtcaaggcctttgaagacaacatggacaattggggtcgc
agttatgtgtttgacggagaagtagtttccacatcgttccaagccttgatgaaagaagta
catcgcaaagaaaatgcacaggcacaggatgctagactcatgctgtttgacatcgtgcca
ttggctgagttcaaagcaggagccagtgtgatggggcaaaagcgccgcagtgctttcctg
cgtgagaacttttccaaactgtttgcagactcaggctgtatcgaaatcatcacacaacga
gaatttgatctagatgtgttcacagatgaaattgagttcaaagactacaacaaacaggca
gtggctgaaggctttgagggcattatgatcaaagatcccaacggcaagtgggaaggcaag
cgaagcgtggcttggctcaaacaaaagcctttcatcgaagtcagccttgctgtgatcgaa
acagaagagggcacaggccgtaatgtgggcaagatgggtgccctggtctgtgaaggcaca
gaagatggcaagctgatccgagtaaacgtgggctcaggctttacggacaaggatcgtgat
gagttttggcagtgcaaggtagatggccaggttattgaagtcagagcagatgctatcaca
cagaaccaagacggtacctatagtctacggtttcctaggttcatgcgattccgtggcttc
aaagcaggagaaaagatatga

DBGET integrated database retrieval system