Georhizobium profundi: D5400_14775 Help Entry D5400_14775       CDS       T05798                                  Name (GenBank) HU family DNA-binding protein   KO K03530   DNA-binding protein HU-beta Organism abaw  Georhizobium profundi Brite KEGG Orthology (KO) [BR:abaw00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:abaw03032]     D5400_14775    03036 Chromosome and associated proteins [BR:abaw03036]     D5400_14775    03400 DNA repair and recombination proteins [BR:abaw03400]     D5400_14775 DNA replication proteins [BR:abaw03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     D5400_14775 Chromosome and associated proteins [BR:abaw03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     D5400_14775 DNA repair and recombination proteins [BR:abaw03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       D5400_14775 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG HU-CCDC81_bac_2 DUF2267 HU-CCDC81_euk_2 Motif Other DBs NCBI-ProteinID:  AZN72370 UniProt:  A0A3Q8XPN5 LinkDB All DBs Position complement(3046587..3046859) Genome browser AA seq 90 aa AA seqDB search MNKNELVAAVAEKTGMAKTEAGSAVEAVFEVITGELKSGGDVRLIGFGNFSVSRREASKG RNPSTGAEVDIPARNVPKFSAGKGLKDSVN NT seq 273 nt NT seq  +upstreamnt  +downstreamnt atgaacaagaatgaactcgtcgctgccgtcgccgagaagaccggcatggcaaagaccgag gcgggctccgctgttgaggccgtcttcgaagtcatcaccggcgaattgaagtcgggtggc gacgtgcgcctcattggttttggaaatttttcggtctcgcgccgcgaagcttcgaagggc cgtaacccctcgactggcgctgaagtggacatcccggcacgcaacgttcccaagttctct gccggtaagggcctcaaggactccgtcaactaa

DBGET integrated database retrieval system