KEGG   Azotobacter chroococcum: Achr_b50
Entry
Achr_b50          ncRNA     T03640                                 

Name
(GenBank) Prr/RsmZ RNA family
Organism
acx  Azotobacter chroococcum
SSDB
LinkDB
Position
pAcX50b:complement(6439..6579)
NT seq 141 nt   +upstreamnt  +downstreamnt
gacgtcgacggatcgacaccggctgaccaggatggtcgccaaggacagtcgcaggatgcg
gcttcatcaggatgatgagtcgacggaagagaagacgacgtaaaacaaaaacggcgaggc
tccccccctcgccgtttttgt

DBGET integrated database retrieval system