KEGG   Alicycliphilus denitrificans BC: Alide_4040Help
Entry
Alide_4040        gene      T01397                                 

Definition
(GenBank) pseudogene
Organism
adn  Alicycliphilus denitrificans BC
SSDB OrthologParalogGene clusterGFIT
LinkDB All DBs
Position
complement(4211255..4211532)
Genome map
NT seq 278 nt NT seq  +upstreamnt  +downstreamnt
cccaacgtgatccgccgtctggcggcgacccagcccatgctcgacaagatcgtcggccac
caacgccacatcgctcaggcctacggcatatcgatggagcatgcgcgctggctgttgacc
accgtggcgttccactgccttgccgtggccgacacggtgtactcggtcgccgaacgggaa
cccgtcgtggatgcagaccgtgcgacggaggaagccgagatggaggccgaactcaacagg
gcatgcacgcactcattgttggcatgctggccttgatg

DBGET integrated database retrieval system