Tsuneonella dongtanensis: A6F68_02673 Help Entry A6F68_02673       CDS       T04466                                  Symbol tyrA_2 Name (GenBank) T-protein   KO K04092   chorismate mutase [EC:5.4.99.5] Organism ado  Tsuneonella dongtanensis Pathway ado00400   Phenylalanine, tyrosine and tryptophan biosynthesis ado01100   Metabolic pathways ado01110   Biosynthesis of secondary metabolites ado01230   Biosynthesis of amino acids Module ado_M00024   Phenylalanine biosynthesis, chorismate => phenylpyruvate => phenylalanine ado_M00040   Tyrosine biosynthesis, chorismate => arogenate => tyrosine Brite KEGG Orthology (KO) [BR:ado00001]  09100 Metabolism   09105 Amino acid metabolism    00400 Phenylalanine, tyrosine and tryptophan biosynthesis     A6F68_02673 (tyrA_2) Enzymes [BR:ado01000]  5. Isomerases   5.4  Intramolecular transferases    5.4.99  Transferring other groups     5.4.99.5  chorismate mutase      A6F68_02673 (tyrA_2) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  CM_2 Motif Other DBs NCBI-ProteinID:  ANY21166 UniProt:  A0A1B2AG99 LinkDB All DBs Position 2711182..2711472 Genome browser AA seq 96 aa AA seqDB search MAETPDPTLAGFRKSIDNIDAALIHMLAERFRITQAVGEYKARAALPPADPAREAAQIAR LRALAEDAHLDPEFSEKFIRFVIDEVIRHHEKARGA NT seq 291 nt NT seq  +upstreamnt  +downstreamnt atggccgagacacccgatcccaccctcgcgggcttccgcaagagcatcgacaacatcgac gcggcgctgatccacatgctcgcggagcggttccggatcacccaggcggtgggcgaatac aaggccagggccgcccttccccccgccgaccctgcccgcgaggctgcgcagatcgcccgc ctgcgcgcgctggccgaggatgctcatctcgaccccgaattcagcgagaagttcatccgc ttcgtgatcgacgaggtcatccggcaccacgagaaggcacgcggggcctag

DBGET integrated database retrieval system