KEGG   Aeromonas hydrophila pc104A: V429_20575
Entry
V429_20575        tRNA      T03193                                 

Definition
(GenBank) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
ahp  Aeromonas hydrophila pc104A
Pathway
ahp00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:ahp00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    V429_20575
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:ahp03100]
    V429_20575
Non-coding RNAs [BR:ahp03100]
 Transfer RNA
  V429_20575
SSDB
LinkDB
Position
complement(4449183..4449259)
NT seq 77 nt   +upstreamnt  +downstreamnt
gcgcccgtagctcagctggatagagtacctggctacgaaccaggtggtcagaggttcgaa
tcctctcgggcgcacca

DBGET integrated database retrieval system