KEGG   Apis mellifera (honey bee): 724634Help
Entry
724634            CDS       T01057                                 

Gene name
lva
Definition
(RefSeq) golgin subfamily B member 1
  KO
K20478  golgin subfamily B member 1
Organism
ame  Apis mellifera (honey bee)
Brite
Membrane trafficking [BR:ame04131]
 Endoplasmic reticulum (ER) - Golgi transport
  Retrieval pathways
   Rab associated proteins
    724634 (lva)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 724634
NCBI-ProteinID: XP_016768803
BEEBASE: GB40808
LinkDB All DBs
Position
LG1
AA seq 3601 aa AA seqDB search
MWSASEEPPGTMEGDAPESMLHAKEKCEQNKSQLESLKEIMLKNKQSLKKKEEEVQEYAR
RLSKIKSRAKLSRRNREGNLPSKDIARISETALTDTPEENIDDISQAKTAKAKSTLLQKK
LAENRKAFEQRNKEISETKRAVEEKVEAIRQQLEEKDVTVMAFQKDQISITAVKPVMITS
DIMSPIQIESIQEKESKITELNNKILELEATIMDLQENLKEKDSVIESKTKAVTLMSADL
SKRGKTTLDTLEDTKDEMRTMQEHFVLLETSLKNKNENLLMQLQERDDKIVELEDSVDRF
RKQINEQKLSETASVDFSRSTMDTLVETKEAMKSMQENFVLMESSLKAKNDNLLEQLKDY
ELKLAEANERVFKLESGIGIVRDPTVDELQFKLEKLEHNNKQLQDEKYELQKSVAELQDK
IVNISMHGNGAIVEKDNRIIELENLVEELKQSNKFLEEESKAELQKQVADLTLKNEEYSN
KITDLENFVHKLEEEKNEITAKLPEEGIIKEDEKVAKLTKELEELNKNMIKIKAKHKSKI
KSLQQQLENFKKISDTNAELVRLGNQVALLEEEKGNLQLSLVDFDELKASAGDWQERVVD
LESKVSAQTKEIEMQIEAIATLENQKLDLLQELHMAKQEISSLEAENAESENLRVTAEIK
VVDLEEQLEAIHRMQNESKLESSSEVNSAELIKQVETLTQENTELYNRISKFEEKGTSDT
GSTESFEAIQELDKTDLLKKIEDLTQKNNELTLKLNKLQEKENADSIESMNNIDKNELLK
KIDQLTQENTDLTMKLSRVEEKGSSDTGSTESFERIPENNESMTKIELLTQENSELVIKL
TKLEEQLEYIESKSDIDLKLKIDTLEQENDNQSIELSKLKIQLMDFIEENNRLHKEIEML
SINNTDLTIEPHKLEIETKQSEESEISKRDVDFKTQVNILMEEKDLLQKEVKELRNSLEQ
WHEKNQDLQINDLRTKIEELLRENEEVVTKMSELKTSNQKLEENVIKITQEKEELNLKLN
QMLDSNNETLKLTEKLDKLNLEKQNIQEKKQLDEQIDIPLEKSDQELLKTPQLDEPLSQQ
TESTIVASLEQEIEKCKNLIAEQTGLIEEMKIKLVNKEKELEEKSQQIVDCERSGKKVET
LENELREMFSTIEEWRYKCNEMEEKMEKLEVGKASIEEKFRILQNENKILLEENKEKDAE
TVLLKKQLQDTTVTFESKLERQISIISEKENEIIRLKETIEEKDQELQAKYTELQNKMIT
IDSLQDEFNNCKMLIQEKDTSITSMTNEVANLNNLVKSKEEEIYSLRKNITELSDKLEQS
IPVKDYNDLMEKLKDKNMIVDELECRINATTKENSNLSEKVKNLSQQNNDIQNQLTEKQR
ELVDLITTKDHLEAEIVETKDEKGEVERRVWELQTIIDNNTKFVNDLQTELRSNYKQMEQ
LKSKHAEDTQLQNQRLETVIEELTAKMRECEILKEELEQKERLIGRNVTEEAKVALESKV
ADLEKRLKDSEEKVQLQLEKMKKIAANLKKKTAVCQELETRVAELEEKWTTEKDEKEAKN
KQIQDVEITIREKDNRIADLEEKLAQSRNESSQASKNIERLTTDSSNLKEKMASLTQQIA
EMEEEIVKLRVDLESSTTDLTLEKESRQLVSSEYESYRRQVVQENERRQLELDEMKEKAR
ELSVRMQVMEAEYVEHLTLINDLKAENGLLLSKQAHINEKLETVEKESEERRLLLEQLEK
AAVVNTRAEATQTQGEEEMANEDEGKTSGALQHCTHCEQCQTLVQALEAKLQEREAEIEN
LDNELANSIGNFVQMRESLRFNDLMNQTGMRNRTLEDPYNDLLFQYNSLASSHEEVKVSL
EKASRENEELRGTVDQLRVTNDTFQERITTLENVDALNSDLVKKWEERERELLNARQELE
IVQRRGDELERRLNAQAESLKSVEARREAAEKSLRDTKESLEREIESLRMDKDSSERKMK
DLETELDAWRSRESFDAPPRDNAPQLFDASRIFGSAPSPLDSEPLADREEVKRLRSLLEE
REAQCSNLTQEVYQLQGTLSEERRLIEGLKASQKELSTNLERAERSVAEKEKQVESLDAE
LRNSTIRMEDELRESLSAKDEQLKELNARLDSVKETLEEALVERDRQHSLLRSYESQIND
LEMELRNSTDLDALQDLEKRVLSLTKERDLLQLQVNDLTRSMEELKDSINRGRNSEMEKV
GRERDEARETIASLSRALEEARERQSDKATVTDDTSTKESLERRASKIEERSVSLDVGEM
EKINVDEEIWGWNTEDAQLDSEQAMASTILIPSTEIQLRAKVDDLQDQVKDLERERARMG
EENKAAQLRNAKMLKKLKEYKAQAESLQQQLKIQKTAADFYGLDSAIEEELKSQIGKLEK
NLNEVKEERRNTVAEKEALMKRLDVVVSANERYMEMKERQDMDMEDSTFRLVEDDTSSEQ
KVATQEQASSSREKRSLPKEADLESLSKRYKEEMDDLKDEMEALATENEQLQHFLEEQKI
KLSALESKRSAEEDESIQIVDDLNGKISELQAVLSKSREEYDLLRKQYEQSLMDANDQVT
AMRQNADYLKEEAFERTAKLEMEIVDLRQQLEASELNVTELRKGLEDALREKSSVEERLT
DLTASTEKQVSSLNASMLEVTDLLNTRIQEVADLRQELQKQYVEHEEAKTRLQSTVKESN
RELDEKRQEMEDLRRSFAEREKEFVERQSVETVSALVSQATQELMQRHAIEIEERDKHVR
NLNERLSALEATANECLLEKRNNVVQLDARIQELELLRRDLMEKESSLASVREGFASMEK
QLAQRELELSEREETIRKLSLENQRCVETVEELRKRLNESATISANVNEYTLRVQTLERE
VENMRSLLDEKEAILRKNVEEATEYREIIEKSRIELSELRMEVQKVEDLKNELLEKEERV
NSLNSELEATRKALEETRQNLNEKMSLLDHSNRLLNERQMEIDRLSSLQQDRRSSANMID
GLPVFRMGNGEQNLQHTIDNMQVELERKQEEIEHLKYILNENTYPGIIQEMQQRIHCLYN
EKAELESSLLVINARAEEKEKQIHALEQRIETQSQEFVSKEELHSRDRRSIQEQEQIVRL
QNELYAKEQEINELKYIVAEKESQLSVQASMEPQSDEFELREMVQRLTAELYGKEEEVKH
TKLTIVELQREVSRLQEFERFSEQTREAVQKLNAEKEQIRLEGEEFLERRLKEKEMEIDE
IKRNLAMENQKILDELSFNNRDIESLKSQLTELSTTEQRTKDELRRREEDLLRVNSDLAE
KKRRLAELSITKDAELHNLKIQISEKDARIEELVSLYEEGEKRFTELKNTLSAREIEINS
LKTLLEDKVKEYQLIQNVLKKDVSVLDTSTSTTNPNTETSDDKSKTSTSQELDLALYMLH
QRDVRCEELTHELMQLLEERDTLQLRLSNAIRVNEDLRKGTLTNVDLSPKMEPSTSGGTV
EPIVEHPSPSKSEGPVEIAKEAIDAPIGENKEILAQNFPFRLSQLQTVSHSKDVRLRDER
ELRHTQQMSLLAHKDVLSTLPPEAAARLVNANYTLSRDVQSQSSVLLNWLWGKSTPKVVH
M
NT seq 10806 nt NT seq  +upstreamnt  +downstreamnt
atgtggagtgcatcagaagaaccaccaggaacaatggaaggagatgcacctgaatctatg
ctacatgctaaagaaaaatgtgaacaaaataaaagtcagttggaatctttgaaagaaatt
atgttgaaaaataaacaaagtttaaaaaagaaagaagaggaagttcaggaatatgcaaga
agactttctaaaattaaatctagagctaagttatcacgtcgaaatagagaaggaaatttg
ccttctaaagatatagctcgtatatctgagactgctttaacagatacacctgaagaaaat
attgatgatattagtcaagcaaaaactgcaaaagcaaagtctactttactccaaaaaaag
ctagcagagaatagaaaggcttttgaacaacgtaataaagaaataagtgaaactaaacga
gcagttgaagaaaaagtagaagctattaggcaacaattagaagaaaaagatgtgacagta
atggcttttcaaaaggatcaaatatctattacagctgtaaaaccagtcatgattacttct
gatatcatgtcaccaattcaaatagaaagtattcaagaaaaagaaagtaaaattacagaa
cttaataataaaattttggagcttgaagctacaattatggatcttcaagaaaacttaaaa
gaaaaagattctgttattgaatctaagacaaaggcagttacccttatgtctgcagatctt
tcaaaaaggggtaaaacgacgttagacactctagaagatacgaaagacgaaatgcgaaca
atgcaagaacatttcgtacttttagagacatctttgaaaaataaaaacgaaaatctctta
atgcaattgcaagaaagagatgataaaattgtagaactagaagattcagttgaccgattt
agaaaacagattaatgagcaaaaattatctgagactgccagtgtcgatttttctcgttct
accatggatactttggtagaaactaaagaagctatgaaatcaatgcaagaaaattttgta
ctcatggaatcttcacttaaagcgaaaaacgacaatttgctggaacaattaaaagattat
gaattaaaattagcagaagctaatgaacgagtgtttaaactcgaatctggtataggaata
gtcagagatccaactgttgatgagttgcaattcaaattagaaaaattggaacataataat
aaacaattgcaagatgaaaaatatgaattacaaaaaagcgttgcagaattacaagataaa
attgtaaatatatctatgcatggtaatggtgcaatagtagaaaaagataatagaataatt
gaacttgaaaatttagtagaagagttaaaacaatctaataaatttcttgaagaagaatct
aaagcagaattacaaaaacaagtagcagatttaactttaaaaaatgaagagtattcaaat
aaaataactgatcttgaaaactttgttcataaacttgaagaagaaaaaaatgaaattacg
gcgaagttaccagaagagggtattattaaagaagatgaaaaagtggcaaaacttactaag
gaattagaagaattaaataaaaatatgatcaaaattaaagcaaaacataaaagtaaaata
aaaagtttacaacaacagttggaaaattttaaaaagatatctgatacaaatgcggaactt
gtcaggttggggaatcaagtggcattattagaggaggagaaaggtaaccttcagctgagt
ctggtagactttgacgagcttaaagcctcagcaggagattggcaagaacgtgttgttgat
cttgaaagtaaagtttctgctcaaacgaaagaaattgaaatgcaaattgaagccattgct
actctagagaatcaaaaattggatcttttgcaagagcttcatatggcgaaacaagaaatc
tcgtctttagaagcggaaaatgcagaatctgagaatcttagagtaactgcagaaataaaa
gtcgttgatcttgaagaacaattagaagctattcatagaatgcaaaatgaaagtaaatta
gaatcttcatcagaggttaattctgcagagttaattaaacaagtggaaactttaacgcaa
gaaaatactgaattatataatagaatatcgaaatttgaagaaaaaggaacatctgatacc
ggatctactgaatcatttgaagctatacaagaattagataaaactgatttgttgaaaaaa
atcgaagatttaacacagaaaaataacgaattaactcttaaattgaataaacttcaagaa
aaagaaaatgctgattccatcgaatctatgaataacattgataaaaatgaattattaaag
aaaattgatcaattaacacaagaaaatactgatttaacaatgaaattgagtagagtggaa
gaaaaaggatcctcagatacgggttcgacagaatcttttgaacgaataccagaaaataat
gagagtatgacaaaaattgagcttcttacacaagaaaatagcgaacttgtaattaaactt
acaaaacttgaggaacaattagaatatatagaatctaaatcagatattgatttgaagtta
aagattgatactttggagcaagaaaatgataatcaatctatagaattatcaaaacttaaa
attcaattaatggatttcattgaagaaaataatagattgcataaagaaattgaaatgtta
tctataaacaatactgatttaactattgagccacataaattagaaattgaaactaaacaa
tcagaagagtctgaaatatcgaaaagggatgttgattttaaaacacaagttaacatatta
atggaagagaaagatcttttacaaaaagaagtaaaagaattacgtaattcattggaacag
tggcacgagaaaaatcaggatcttcaaatcaatgatttgagaactaaaatagaagaattg
ttgagagaaaacgaagaagtagttacgaaaatgtcagaacttaaaacctctaatcaaaaa
ttagaagaaaatgtgataaaaattacacaagaaaaagaagaattaaatttaaaacttaat
caaatgttggattctaataacgagactttaaaacttaccgaaaaattagataaattgaat
cttgaaaagcagaatattcaggagaaaaaacaactcgatgaacaaattgatattccttta
gaaaaatctgatcaagaattacttaaaacaccacaattagatgaacctttatcacagcaa
acagaatcgacgatcgttgcttctttggaacaggagatagaaaaatgtaaaaatttgatc
gcagaacaaacaggtctgatcgaagaaatgaaaataaaattagtaaacaaggaaaaggaa
ttagaagagaaaagtcaacagattgtggattgtgaaagatctggaaagaaagttgaaact
ttggaaaatgaattgagagaaatgtttagtactatagaagaatggagatacaagtgcaat
gaaatggaagaaaaaatggagaaattggaagtgggaaaagcttcgatcgaggagaaattt
agaatattgcaaaacgagaataaaatattattggaagaaaataaagagaaagacgcggaa
actgtattactgaaaaaacaattgcaggatacaacggtgacatttgaatcaaagcttgaa
agacaaatttcaataatatctgaaaaagaaaatgaaattatcagattgaaagaaactatc
gaggagaaagatcaagaattacaggcgaaatatacggaactccaaaataaaatgattacg
atagacagtttgcaagatgaatttaacaattgtaaaatgttaatccaagagaaggatact
tcaataacatcgatgaccaacgaagttgcaaatctcaacaatctagtaaaaagcaaagag
gaagaaatatattctttgaggaaaaatattaccgaattgagtgataaactggaacagtcg
atacctgtgaaagattataacgatttgatggaaaaattgaaggataaaaatatgattgtc
gacgagttagagtgcagaattaatgcgaccacgaaagaaaacagtaatttatccgaaaaa
gtgaaaaatttgtcgcagcaaaataacgatattcaaaatcaattaacggagaagcaacgg
gaactcgttgatttaataacaacgaaagatcacttagaagctgaaattgttgaaacgaaa
gacgagaaaggtgaagttgaaaggcgggtctgggaattacagaccattatagacaacaac
acaaagtttgtcaatgatctgcaaacggaattgaggagcaattataaacagatggaacag
ttaaaatcgaagcacgcagaagatacccaactgcaaaaccagagactcgaaaccgtgatc
gaggaattgaccgcgaaaatgcgggaatgcgagatattgaaggaggaattggaacagaaa
gagagattaatcgggcgcaacgtgaccgaggaagcgaaggttgctctggaatccaaggtt
gccgatttggagaagaggttgaaagattccgaggagaaggtgcagttgcaattggaaaag
atgaagaagatagcggccaatctgaagaagaaaactgccgtgtgccaggagctcgagacc
agggtggccgagctcgaagagaaatggacgaccgaaaaggacgagaaagaggcgaagaac
aagcagatccaagacgtggagataacgatccgcgagaaagacaataggatagccgatctc
gaggagaagctagcccaatctagaaacgaatcctcccaagcgtccaagaatatagagagg
ttgaccacggattcgtccaacttgaaggagaagatggcctcgctcacccaacaaatcgca
gagatggaggaggagattgtcaagttgagggtggacctcgagtcttccacgacagatctc
acattggagaaggaaagtaggcagcttgtatcgtcggagtacgaatcttacaggcggcaa
gttgtccaggagaacgagcgcaggcagttggaattggacgagatgaaggagaaggccagg
gagcttagcgtgaggatgcaagttatggaggctgagtacgtggagcaccttaccttaatc
aacgatctcaaggcagagaacggcctcctgttgtccaagcaagcgcatataaacgagaaa
ctggagacggtcgagaaagaatcggaggagagacgattgttgctcgagcagttggagaaa
gcggcggtggtcaacactcgggcggaggccactcagacccaaggagaggaggagatggcg
aacgaggacgaggggaaaacgagcggagctctgcaacactgcacccattgcgagcaatgc
cagacattggtccaagcgttggaagctaagttgcaagagagggaggccgagatagagaat
ttggacaacgagttggccaactcgattggcaattttgttcagatgagggagtccttaagg
ttcaacgatctgatgaatcagacaggtatgaggaacaggacgctggaggatccgtacaac
gatcttttgttccagtacaactcgttggcgtcgagtcacgaggaggtgaaggtgagtttg
gagaaagcgtcgagggagaacgaggaattgagggggacggttgaccaattgcgtgtcacc
aacgacacgttccaagagaggataacgacgttggaaaacgtggacgcgttgaattctgac
ctggttaagaagtgggaggaacgggagcgagagttgttgaacgctcggcaggagttggaa
attgttcagaggcgcggggacgagttggaacggcgtttgaacgcccaggcggagtctctt
aaatccgtggaggcgcggagagaggcggcggagaaatcgttgcgagatacgaaggagagt
ttggaacgggagatcgagtctctgagaatggacaaggactcgagcgagaggaagatgaaa
gatctggagacggagttggacgcgtggaggagcagggagagcttcgatgcacctcctcgg
gacaacgccccccagttgttcgacgcctcgagaatcttcggcagcgcgccatccccgctc
gattccgagcctctggccgacagagaggaggtgaagagattgcgctccttgctggaggag
agggaggcgcaatgctcgaatctgacccaggaggtgtatcagttgcaggggacgttgagc
gaggagaggagactgatcgaggggttgaaagcctcgcaaaaggaactgagcaccaatttg
gagagggcggaacgatcggtggccgagaaggagaaacaagtcgagtcgttggacgccgag
ttgcgtaactcgaccattcgaatggaggatgagctgagggagtcgttgtcggccaaggac
gagcaattgaaggagttaaacgcgaggctggattccgtgaaagagacgttggaggaggcg
ctcgttgaacgcgatcggcaacactccctcctacgatcctacgaatcgcagataaacgat
ctggagatggaattgagaaattccaccgacctcgacgcgctgcaggatctggagaagcgt
gtcctttcgctcacgaaggagagggatttgcttcagttgcaggtgaacgatttgacaaga
tccatggaggagttgaaggactcgatcaaccgtgggcgaaactcggagatggagaaggtt
ggccgagaaagggacgaggctagagaaactatagcgagtcttagccgagcgttggaggag
gcccgcgaacggcaatctgacaaagctaccgttacagatgacacgtcgacgaaggaatca
ttggagcgacgagcctcgaaaatcgaggagaggagcgtttctttggacgttggggaaatg
gagaaaattaacgtggacgaggagatatggggttggaacacggaggacgcccaattggac
agcgaacaagcgatggcgtccacgatcttgatcccgagcacggagattcagttgcgagcc
aaggtggatgatctccaggatcaggtcaaggatttggagagggagagggcgaggatgggg
gaggagaataaggcagctcaactgaggaacgcgaaaatgttgaagaagttgaaggagtac
aaggcgcaggcggagagtctgcaacagcaattgaagatacagaaaacggcggccgatttt
tacggattggactcggccatagaggaggagttgaagtcgcagataggcaagttggagaag
aatttgaacgaggttaaggaggagaggaggaacacggttgccgagaaggaggcgctgatg
aaacggttggacgttgtcgtctcggcgaacgagagatacatggagatgaaagagaggcag
gacatggacatggaggactcgacttttcgcctcgtcgaggatgatacctccagtgaacag
aaagtggccacgcaagaacaagcttcgtccagcagagagaaacgttccctgcccaaggag
gcggatctcgagagtttgtcgaagaggtacaaggaggagatggacgatctcaaggacgag
atggaggcgctcgcgaccgagaacgagcagctgcaacactttctagaggagcaaaagatt
aaactgtccgccctagagtcgaaacgtagcgccgaggaggacgagtccatccagatagtg
gacgacttgaacgggaaaatttctgaattgcaggcggtgttgagcaaatctagggaggag
tacgatctgttgaggaaacagtacgagcagagcttgatggacgctaacgatcaggtgaca
gcgatgaggcagaacgcggattacttgaaagaggaggcgttcgagaggacggccaaactg
gagatggagatagtcgatttgcgccaacagctcgaagcttcggaattgaacgtcacggag
ttgcggaagggtttggaggacgctttgagggagaagtcgagcgtggaggaaagattgacg
gatttaacggcgtccaccgagaagcaagtttcttccttgaacgcttccatgctggaggtg
acggatctcttgaacacgaggatccaggaggtggcggatctgaggcaagagcttcaaaag
cagtacgtggagcacgaggaggcgaaaacgaggttgcagagtactgtgaaagagtcgaat
cgagaattggacgagaagaggcaagagatggaggatttgaggagatcgttcgccgagagg
gagaaggaattcgtcgaacggcagagcgtggaaacggtgagcgccctcgtgagccaggcc
actcaggaattgatgcagaggcacgcgatagaaatcgaggagagggataaacacgtgcga
aatcttaacgagagattgtccgcgttagaagcaactgcgaacgagtgtttgctcgagaaa
cggaacaacgttgttcaactcgacgcaagaatacaagaattggaacttttgagacgggat
ttgatggaaaaggagtcgagtttggcgtctgttcgagagggattcgcgtcgatggagaaa
caattggcccagagagagttggagttgtcagaaagggaggaaacgattcggaaattgtca
ctcgagaatcaaagatgcgtggaaactgtggaggagctgcgtaaacgtttgaacgagtct
gcaacgatctctgccaatgtgaacgagtatacgttgcgtgttcagactttggaacgggaa
gtggaaaacatgagatcactgctagacgagaaagaggctatcttgcgaaagaacgtggag
gaggcgacagagtatagagagattatagaaaaaagtagaatcgaattgagcgaacttcgt
atggaggtgcagaaggtggaagatttgaagaatgaactgttggagaaggaggagcgagtg
aacagtttgaactcggaattggaagcaacccgtaaagctttggaggaaaccaggcaaaac
ttgaacgagaagatgtcccttctagatcacagtaatcggttgttgaacgaaaggcaaatg
gaaattgatagattgtcgagtttgcaacaggatagacgtagctctgccaacatgatagac
ggtttacccgtgttcagaatgggcaacggggagcaaaatttacagcataccatagacaat
atgcaggttgaacttgagaggaagcaagaggagatcgagcatttgaaatatattctgaac
gagaacacgtatccgggtataattcaagagatgcagcaaaggatccattgtctgtacaat
gagaaggcggagttggaatcgtcattgttggtaatcaatgcaagagccgaggaaaaggag
aagcaaatccatgctttggagcaaaggatcgagacacagagccaggaattcgtctccaaa
gaggagcttcattccagggatcgaagatcgatccaggaacaggaacaaattgtcaggctt
cagaacgagttgtatgccaaggagcaagagattaacgaactcaagtacatagtagctgaa
aaagagtctcagttgtccgtccaggcaagcatggagcctcaatcggatgaatttgagcta
cgcgagatggttcaaagattaactgctgaattatacggtaaggaagaggaagttaaacat
acgaaactaactattgtcgaattgcagagggaagtatctcgcttgcaagagtttgaaaga
ttttccgagcagactagagaggctgtacaaaagctcaacgcggagaaggagcagattcgt
ttggagggtgaggaatttttggagaggaggttgaaagagaaggaaatggaaatcgatgag
ataaagcgaaacttagctatggagaatcaaaaaatcttggacgagttgtcgttcaacaat
agagacattgaaagtctgaagagtcagctgacggagttgtccacgactgagcaaagaacc
aaagatgaattacgtcggagggaggaggatctgttgcgggtaaattctgatttggcggag
aagaaacgaagattggccgaactgagcattaccaaagacgcggagcttcacaacttgaag
atacaaatttctgagaaggacgcgcgcatagaggaactcgtatcgttgtacgaggaggga
gagaaacggtttaccgaattgaagaatactttgtcggccagagagatcgaaatcaattcg
ttgaagacacttttagaggacaaagtaaaggaatatcaattgatacaaaacgttttaaaa
aaagacgtatccgttctggatacttcaactagtacaaccaacccaaatacggaaacctct
gatgacaagagtaaaacgtcaacgtcgcaggaattagatcttgcgttgtacatgcttcat
caaagagacgtaagatgcgaggaattgacgcacgaattgatgcagttactcgaggaacgc
gatacgttgcaattacgcctctctaacgcgatcagagttaatgaagacttgaggaaaggt
actttaacgaatgtagacctcagcccgaaaatggagccatccacttctggaggcaccgtg
gaaccaattgtggaacatccttcaccatccaagtctgagggaccagtcgagatagccaaa
gaagctattgacgcaccgattggggaaaacaaggaaatccttgcccaaaattttcccttc
aggctgtcacaactgcaaacggtgagccattcaaaagatgtgcgattgagggatgaacga
gagttgagacacacacaacaaatgtctttactagcacacaaagacgttttaagtacttta
ccccctgaagcagctgccagactcgtcaatgcaaattacacactctctagggatgtccag
agtcaatcgagtgttttgttaaattggctatggggaaaaagtacgccaaaagtggtacat
atgtga

DBGET integrated database retrieval system