KEGG   Ailuropoda melanoleuca (giant panda): 100474991
Entry
100474991         CDS       T01329                                 

Gene name
PMAIP1
Definition
(RefSeq) phorbol-12-myristate-13-acetate-induced protein 1
  KO
K10131  phorbol-12-myristate-13-acetate-induced protein 1
Organism
aml  Ailuropoda melanoleuca (giant panda)
Pathway
aml01524  Platinum drug resistance
aml04115  p53 signaling pathway
aml04210  Apoptosis
aml04215  Apoptosis - multiple species
aml05200  Pathways in cancer
aml05203  Viral carcinogenesis
aml05210  Colorectal cancer
Brite
KEGG Orthology (KO) [BR:aml00001]
 09140 Cellular Processes
  09143 Cell growth and death
   04210 Apoptosis
    100474991 (PMAIP1)
   04215 Apoptosis - multiple species
    100474991 (PMAIP1)
   04115 p53 signaling pathway
    100474991 (PMAIP1)
 09160 Human Diseases
  09161 Cancer: overview
   05200 Pathways in cancer
    100474991 (PMAIP1)
   05203 Viral carcinogenesis
    100474991 (PMAIP1)
  09162 Cancer: specific types
   05210 Colorectal cancer
    100474991 (PMAIP1)
  09176 Drug resistance: antineoplastic
   01524 Platinum drug resistance
    100474991 (PMAIP1)
SSDB
Motif
Pfam: PMAIP1 Bclx_interact
Other DBs
NCBI-GeneID: 100474991
NCBI-ProteinID: XP_034498049
LinkDB
Position
14
AA seq 54 aa
MPGKKARKSAQASPARTPAEPEVECAIQLRRFGDKLNFRQKLLNLISKLFRSGT
NT seq 165 nt   +upstreamnt  +downstreamnt
atgcctgggaagaaagcgcgtaagagcgcgcaggcgagtcctgcgcggaccccggcagag
cccgaagtggagtgcgccattcaactcaggagatttggagacaaactgaatttccggcag
aaacttctgaatctgatatccaaactcttccgctcaggaacctga

DBGET integrated database retrieval system