KEGG   Actinomyces radicidentis: AXF14_10455Help
Entry
AXF14_10455       CDS       T04288                                 

Definition
(GenBank) shikimate kinase
  KO
K00891  shikimate kinase [EC:2.7.1.71]
Organism
ard  Actinomyces radicidentis
Pathway
ard00400  Phenylalanine, tyrosine and tryptophan biosynthesis
ard01100  Metabolic pathways
ard01110  Biosynthesis of secondary metabolites
ard01130  Biosynthesis of antibiotics
ard01230  Biosynthesis of amino acids
Module
ard_M00022  Shikimate pathway, phosphoenolpyruvate + erythrose-4P => chorismate
Brite
KEGG Orthology (KO) [BR:ard00001]
 09100 Metabolism
  09105 Amino acid metabolism
   00400 Phenylalanine, tyrosine and tryptophan biosynthesis
    AXF14_10455
Enzymes [BR:ard01000]
 2. Transferases
  2.7  Transferring phosphorus-containing groups
   2.7.1  Phosphotransferases with an alcohol group as acceptor
    2.7.1.71  shikimate kinase
     AXF14_10455
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: SKI CPT
Motif
Other DBs
NCBI-ProteinID: AMD88560
UniProt: A0A0X8JGV1
LinkDB All DBs
Position
2457768..2458304
Genome map
AA seq 178 aa AA seqDB search
MTAACDLTASVVLVGVPGAGCSSVSEALGGLTGAPVADLAAIVAEELGTAPELALVAVPE
ARYREVESATALALLSEATARPGVVALGSGCLADEDVVAALDEVRGADGRVVALTASTRR
LSTRNGLDAPRSVGLGNVHHEFVQALHAREARCREVADAVVDTSETTPAEAAQAVLGA
NT seq 537 nt NT seq  +upstreamnt  +downstreamnt
atcacggccgcctgcgacctcaccgcctccgtcgtcctcgtcggggtgcccggcgccggc
tgctcgagcgtctccgaggctctcggcgggctcaccggggcgcccgtggccgacctcgcc
gccatcgtcgccgaggagctcggcaccgcccccgagctcgccctcgtggccgtgcccgag
gcccgctaccgcgaggtcgagagcgcgacggccctcgcgctgctgtccgaggcgacggcg
cgccccggtgtcgtcgccctcggctccgggtgcctggcggacgaggacgtcgtcgccgcc
ctcgacgaggtccgtggagcggacggacgggtcgtcgccctcaccgcgagcacgcgccgg
ctgtccacccgcaacgggctggacgcgccgcgctcggtcgggctgggcaacgtgcaccac
gagttcgtccaggccctccacgcccgcgaggcccggtgccgggaggtcgccgacgccgtc
gtcgacacgagcgagacgacgcccgccgaggcggctcaggcggtcctgggggcctga

DBGET integrated database retrieval system