KEGG   Bacillus amyloliquefaciens TA208: BAMTA208_t20707Help
Entry
BAMTA208_t20707   tRNA      T01824                                 

Definition
(GenBank) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
baz  Bacillus amyloliquefaciens TA208
Pathway
baz00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:baz00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BAMTA208_t20707
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:baz03100]
    BAMTA208_t20707
Non-coding RNAs [BR:baz03100]
 Transfer RNA
  tRNA
   BAMTA208_t20707
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
LinkDB All DBs
Position
466848..466929
Genome map
NT seq 82 nt NT seq  +upstreamnt  +downstreamnt
gcgggtgtggcggaattggcagacgcgctagacttaggatctagtgtcttacgacgtggg
ggttcgagtcccttcacccgca

DBGET integrated database retrieval system