KEGG   Bifidobacterium dentium Bd1: BDP_tRNA15Help
Entry
BDP_tRNA15        tRNA      T01143                                 

Definition
(GenBank) tRNA-Met
  KO
K14230  tRNA Met
Organism
bde  Bifidobacterium dentium Bd1
Pathway
bde00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bde00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BDP_tRNA15
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bde03100]
    BDP_tRNA15
Non-coding RNAs [BR:bde03100]
 Transfer RNA
  BDP_tRNA15
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
LinkDB All DBs
Position
502283..502359
Genome map
NT seq 77 nt NT seq  +upstreamnt  +downstreamnt
ggcgggatagctcagctggctagagcgtacgactcataatcgtaaggtcaagagttcgag
tctctttctcgctacaa

DBGET integrated database retrieval system