KEGG   Brachybacterium ginsengisoli: CFK41_08615Help
Entry
CFK41_08615       CDS       T05099                                 

Definition
(GenBank) DNA primase
Organism
bgg  Brachybacterium ginsengisoli
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ATG54819
UniProt: A0A291GX88
LinkDB All DBs
Position
1934485..1934796
Genome map
AA seq 103 aa AA seqDB search
MNSDPRSALAALIAAFERHYEAAAASRGDDDPALDAATEQLATAFDAYDDALFDAYEIAT
PLIVFDDDDEDDDEDDDFEDLDDFDEDDEDGDFEDDDDDDSGR
NT seq 312 nt NT seq  +upstreamnt  +downstreamnt
atgaactcggatcctcgctccgctcttgctgcgctgatcgctgccttcgaacgtcactac
gaggcggccgccgcctcgcgcggtgacgacgaccccgccctcgatgccgccaccgagcag
ctcgccacggcgttcgacgcctacgacgacgccctcttcgacgcctacgagatcgccacc
ccgctgatcgtcttcgacgacgacgatgaggacgatgacgaggacgacgacttcgaggat
ctcgacgacttcgacgaggacgacgaggacggcgacttcgaggacgacgacgacgacgac
tccggccgctga

DBGET integrated database retrieval system