KEGG   Burkholderia oklahomensis E0147: DM82_3737Help
Entry
DM82_3737         tRNA      T03284                                 

Definition
(GenBank) tRNA-Gln
  KO
K14223  tRNA Gln
Organism
bok  Burkholderia oklahomensis E0147
Pathway
bok00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bok00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    DM82_3737
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bok03100]
    DM82_3737
Non-coding RNAs [BR:bok03100]
 Transfer RNA
  DM82_3737
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
LinkDB All DBs
Position
1:complement(4174438..4174514)
Genome map
NT seq 77 nt NT seq  +upstreamnt  +downstreamnt
aggggagtcgccaagttggtcaaggcaccggattttgattccggcatgcgagggttcgag
tccttcctcccctgcca

DBGET integrated database retrieval system