KEGG   Bos mutus (wild yak): 102283497
Entry
102283497         CDS       T02919                                 

Gene name
SRF
Definition
(RefSeq) serum response factor
  KO
K04378  serum response factor
Organism
bom  Bos mutus (wild yak)
Pathway
bom04010  MAPK signaling pathway
bom04022  cGMP-PKG signaling pathway
bom05166  Human T-cell leukemia virus 1 infection
bom05203  Viral carcinogenesis
Brite
KEGG Orthology (KO) [BR:bom00001]
 09130 Environmental Information Processing
  09132 Signal transduction
   04010 MAPK signaling pathway
    102283497 (SRF)
   04022 cGMP-PKG signaling pathway
    102283497 (SRF)
 09160 Human Diseases
  09161 Cancer: overview
   05203 Viral carcinogenesis
    102283497 (SRF)
  09172 Infectious disease: viral
   05166 Human T-cell leukemia virus 1 infection
    102283497 (SRF)
Transcription factors [BR:bom03000]
 Eukaryotic type
  beta-Scaffold factors with minor groove contacts
   MADS-box responders to external signals
    102283497 (SRF)
SSDB
Other DBs
NCBI-GeneID: 102283497
NCBI-ProteinID: XP_005900171
LinkDB
Position
Un
AA seq 304 aa
MITSETGKALIQTCLNSPDSPPRSDPTTDQRMSATGFEETDLTYQVSESDSSGETKDTLK
PAFTVTNLPGTTSTIQTAPSTSTTMQVSSGPSFPITNYLAPVSASVSPSAVSSANGTVLK
STGSGPVSSGGLMQLPTSFTLMPGGAVAQQVPVQAIQVHQAPQQASPSRDSSTDLTQTSS
SGTVTLPATIMTSSVPTTVGGHMMYPSPHAVMYAPTSGLADGSLTVLNAFSQAPSTMQVS
HSQVQEQGGVPQVFLTAPSGTVQIPVSAVQLHQMAVIGQQAGSSSNLTELQVVNLDAAHS
TKSD
NT seq 915 nt   +upstreamnt  +downstreamnt
atgatcaccagtgagactggcaaggcactgattcagacctgcctcaactcgccagactct
ccaccccgctcagaccccaccacagaccagagaatgagtgccaccggctttgaagagaca
gacctcacctaccaggtgtcggagtccgacagcagtggggagaccaaggatacactgaag
ccggcgtttaccgtcaccaacctgccgggtaccacctccaccatccagacagcacccagc
acctctaccaccatgcaagtcagcagcggcccctcctttcccatcaccaactacctggca
ccagtgtctgctagtgtcagccccagcgctgtcagcagtgccaacgggactgtgctgaag
agtacgggcagtggccccgtttcctccggaggcctcatgcagctgcctaccagcttcacc
ctcatgcccggtggggcagtggcccagcaggtcccagtgcaggccattcaggtgcaccag
gccccacagcaagcgtctccctctcgcgacagcagcacagacctcacgcagacctcctcc
agcgggacagtgacgttgcctgccaccatcatgacgtcatctgtgcccacaactgtgggc
ggccacatgatgtaccccagcccccatgcggtgatgtatgcgcccacctcgggcctggct
gatggcagcctcactgtgctcaatgccttctcccaggcgccatccaccatgcaggtgtcc
cacagccaggtccaggagcaaggtggcgtcccccaggtgttcctcacagcaccatctggg
acagtgcagatcccagtttctgcagttcagcttcaccagatggctgtgatagggcagcag
gccgggagcagcagcaacctcaccgaattacaggtggtgaacctggatgccgcccacagc
accaagagtgactga

DBGET integrated database retrieval system