KEGG   Burkholderia pseudomallei MSHR511: BBQ_4110Help
Entry
BBQ_4110          CDS       T03012                                 

Definition
(GenBank) putative lipoprotein
Organism
bpsm  Burkholderia pseudomallei MSHR511
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AHG38186
LinkDB All DBs
Position
2:699099..700370
Genome map
AA seq 423 aa AA seqDB search
MHAFRCRRSPPVPLAIVALACACVFGAPRARAAAAHADAPVAASIASFEPAGGPAAAADA
ADTAVMPAPPASFAPPAAPPVPRVATLASSASTVPTTPAATTATTVPPAPIASAPAATPL
SAPPLAPPLAPPAAAPLVIVPRRFDDTALVKVDPEGMSDGWSLAEVAPNQENQPALPEAL
VAHVQAPAQRHTELSLAYSMAHLTNGYGDWYGVHLRGLYQAGGRTIIGELAQLHRFNEST
QLGAITYIQDMGPDWFGGIGFSGTTSGTILPSARVDLSLNRKLLSNRSLVLSAGAGYAWN
RNGHRDQLYHLGAIWYAVPKWIFEAGWNYTVDSPGSVKAPAYYGAITYGEVGKSLIVLRG
SFGREAYQATGNNAQITDFRSHEVSLKWRYWVTRKWGTQVEFDYYHNPYYSRIGGEIGMF
YRW
NT seq 1272 nt NT seq  +upstreamnt  +downstreamnt
atgcatgcgtttcgttgccgacgcagcccgcccgttcctctcgccatcgtggcgctcgcg
tgcgcgtgcgtattcggcgcgccgcgcgcgagggcggccgccgctcatgccgacgcgccg
gttgccgcgtcgatcgcgtcgttcgagcccgccggcgggccggccgctgcggcggacgcc
gccgatacggccgtgatgcccgcgccgcctgcgtcgttcgcgccgcctgctgcgccgccc
gtgccgcgggtcgcgacgcttgcttcgtctgcatcgactgtgccgacaaccccggcagcg
acgacagcgacgacagtaccgccagcaccgatcgcgtccgcaccggccgccacgcccctt
tccgcgccgccgctcgcgccgccgctcgcaccgccggccgccgcaccgctcgtcatcgtt
ccgcgccgcttcgacgacacggcgctcgtgaaggtcgacccggaaggcatgtccgacggc
tggtcgctcgccgaggtcgcgccgaaccaggaaaaccagccggcgctgccggaggcgctc
gtcgcgcacgtgcaggcgccggcgcagcggcacaccgagctctcgctcgcgtattcgatg
gcgcacctgacgaacggctatggcgactggtacggcgtgcacctgcgcgggctctatcag
gcgggcggccgcacgatcatcggcgagctcgcgcaactgcaccgcttcaacgaaagcacg
cagctcggcgcgatcacgtacatccaggacatggggccggactggttcggcggcatcggg
ttttccggcacgacgtccggcacgatcctgccgagcgcgcgcgtcgatctgtcgctcaac
cgcaagctgctgtcgaatcgctcgctcgtgctgtcggcgggcgcgggctacgcgtggaac
cgcaacggccaccgcgatcagctctaccacctcggcgcgatctggtatgcggtgccgaag
tggatcttcgaggcgggctggaattacacggtcgattcgccgggctcggtgaaggcgccc
gcctactacggcgcgatcacctacggcgaggtcggcaagagcctgatcgtgctgcgcggc
agcttcggccgcgaggcgtatcaggcgaccggaaacaacgcgcagatcaccgatttccgc
agccacgaggtgtcgctgaagtggcgctactgggtcacccgcaagtggggcacgcaagtc
gagttcgattactaccacaacccgtactattcgcgcatcggcggcgaaatcgggatgttc
taccggtggtga

DBGET integrated database retrieval system