KEGG   Bacillus subtilis subsp. subtilis 6051-HGW: BSU6051_03359Help
Entry
BSU6051_03359     CDS       T02503                                 

Gene name
yczL
Definition
(GenBank) YczL
Organism
bsh  Bacillus subtilis subsp. subtilis 6051-HGW
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AGG59678
LinkDB All DBs
Position
365850..366035
Genome map
AA seq 61 aa AA seqDB search
MKSGKASIKDLAVGKGKDLRWGKGLNAVGVFTDLEIGRQREMSAKSCSTPLYIRRSIQFK
S
NT seq 186 nt NT seq  +upstreamnt  +downstreamnt
gtgaaaagcggaaaggcatcgattaaggatcttgctgtcggcaaaggcaaggatttgcga
tggggaaaaggattaaacgcggttggagtctttactgatttagaaatcgggcggcagcga
gaaatgagcgcgaaaagctgctctacaccattgtacatacggcgaagtattcaatttaaa
tcgtaa

DBGET integrated database retrieval system