KEGG   Bacillus subtilis subsp. natto BEST195: BSNT_06716Help
Entry
BSNT_06716        CDS       T02607                                 

Definition
(GenBank) hypothetical protein
  KO
K06353  phosphatase RapC regulator
Organism
bso  Bacillus subtilis subsp. natto BEST195
Pathway
bso02024  Quorum sensing
Brite
KEGG Orthology (KO) [BR:bso00001]
 09140 Cellular Processes
  09145 Cellular community - prokaryotes
   02024 Quorum sensing
    BSNT_06716
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: PhrC_PhrF CLLAC
Motif
Other DBs
NCBI-ProteinID: BAO93246
UniProt: A0A060PEN0
LinkDB All DBs
Position
426558..426662
Genome map
AA seq 34 aa AA seqDB search
MFVICLAAAAIFTAAGVSANAEALDFHVTERGMT
NT seq 105 nt NT seq  +upstreamnt  +downstreamnt
ttgtttgttatttgtttggccgcagccgcgatttttacagcggctggcgtttctgctaat
gcggaagcactcgactttcatgtgacagaaagaggaatgacgtaa

DBGET integrated database retrieval system